Incidental Mutation 'R1521:Cacna1h'
ID 167052
Institutional Source Beutler Lab
Gene Symbol Cacna1h
Ensembl Gene ENSMUSG00000024112
Gene Name calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms Cav3.2, alpha13.2, T-type Cav3.2
MMRRC Submission 040870-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1521 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 25374285-25433783 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25397354 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 184 (M184V)
Ref Sequence ENSEMBL: ENSMUSP00000125541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078496] [ENSMUST00000159048] [ENSMUST00000159610] [ENSMUST00000159623]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000078496
AA Change: M184V

PolyPhen 2 Score 0.573 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077586
Gene: ENSMUSG00000024112
AA Change: M184V

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 138 418 8.4e-65 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 824 1011 4.7e-46 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1341 1565 4.5e-56 PFAM
low complexity region 1576 1602 N/A INTRINSIC
Pfam:Ion_trans 1656 1864 7.8e-48 PFAM
Pfam:PKD_channel 1714 1871 1.2e-10 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159048
AA Change: M78V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000123741
Gene: ENSMUSG00000024112
AA Change: M78V

DomainStartEndE-ValueType
Pfam:Ion_trans 32 312 8e-65 PFAM
low complexity region 394 405 N/A INTRINSIC
low complexity region 409 425 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 602 617 N/A INTRINSIC
Pfam:Ion_trans 718 905 4.6e-46 PFAM
low complexity region 1024 1041 N/A INTRINSIC
low complexity region 1142 1153 N/A INTRINSIC
Pfam:Ion_trans 1235 1459 4.3e-56 PFAM
low complexity region 1470 1496 N/A INTRINSIC
Pfam:PKD_channel 1524 1608 1.6e-6 PFAM
Pfam:Ion_trans 1550 1758 7.6e-48 PFAM
Pfam:PKD_channel 1609 1765 1.2e-10 PFAM
Blast:Tryp_SPc 1809 1854 9e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000159610
AA Change: M184V

PolyPhen 2 Score 0.573 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125541
Gene: ENSMUSG00000024112
AA Change: M184V

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 99 430 7e-79 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 789 1023 2.4e-58 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1304 1577 4.5e-65 PFAM
Pfam:Ion_trans 1621 1876 4.2e-59 PFAM
Pfam:PKD_channel 1629 1715 9.3e-7 PFAM
Pfam:PKD_channel 1713 1871 2.2e-11 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159623
SMART Domains Protein: ENSMUSP00000125664
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161454
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Voltage-dependent Ca(2+) channels mediate the entry of Ca(2+) ions into excitable cells and are involved in a variety of Ca(2+)-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. The protein encoded by this gene is an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutation of this locus results in constitutive coronary arteriole contraction and focal myocardial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,987,235 L104P possibly damaging Het
Adgrf5 T C 17: 43,430,552 V360A probably benign Het
Ahnak G A 19: 9,004,728 M1125I probably benign Het
Akap12 T C 10: 4,354,804 V538A probably benign Het
Arhgef10l T C 4: 140,515,438 D1088G possibly damaging Het
Atp7b A T 8: 22,027,673 L268Q probably damaging Het
Atxn2 A C 5: 121,779,591 N516T probably damaging Het
Cacnb2 G T 2: 14,614,352 R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 E96G probably damaging Het
Ccdc78 G T 17: 25,788,781 R264L probably damaging Het
Cdh4 G A 2: 179,797,558 R166H probably damaging Het
Cog7 C T 7: 121,930,574 D615N possibly damaging Het
Crtc2 T C 3: 90,257,383 V115A probably benign Het
Crybg1 A G 10: 43,998,416 S899P probably damaging Het
Ctdnep1 T A 11: 69,988,635 V128E probably damaging Het
Ctnna3 A G 10: 64,959,842 K780E probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dazap2 T A 15: 100,618,065 Y91* probably null Het
Dcdc5 T C 2: 106,351,669 noncoding transcript Het
Dppa1 T A 11: 46,610,473 R74S possibly damaging Het
Elovl1 A T 4: 118,432,000 T241S probably benign Het
Eya1 G T 1: 14,274,550 Q86K probably damaging Het
Fam71a T A 1: 191,164,022 R141S probably benign Het
Fancm A T 12: 65,121,704 M1614L probably benign Het
Fcgbp C T 7: 28,075,160 T53I probably benign Het
Fpr3 T A 17: 17,971,015 W183R probably damaging Het
Galnt13 G A 2: 54,854,645 V119I probably benign Het
Gcfc2 T C 6: 81,923,812 S36P probably benign Het
Gdap2 T A 3: 100,194,615 D412E possibly damaging Het
Gm10184 T A 17: 89,910,306 N4I possibly damaging Het
Gm12258 T C 11: 58,859,555 C41R probably damaging Het
Grrp1 T C 4: 134,251,350 *272W probably null Het
Hipk1 T G 3: 103,777,782 E172D probably benign Het
Hmgcs1 T G 13: 119,703,591 L326R probably benign Het
Hs6st1 C A 1: 36,068,886 R77S probably damaging Het
Ifit3 A T 19: 34,587,173 N40Y probably damaging Het
Il1a T A 2: 129,304,741 Q144L possibly damaging Het
Itga7 A G 10: 128,957,811 E1128G possibly damaging Het
Itih2 T C 2: 10,106,747 D460G probably damaging Het
Ivns1abp G A 1: 151,351,558 C39Y probably damaging Het
Kif22 G T 7: 127,027,839 A646E probably damaging Het
Klhl29 T C 12: 5,091,307 Y559C probably damaging Het
Klhl7 T A 5: 24,149,110 probably null Het
Klhl9 A G 4: 88,721,993 S4P probably benign Het
Klk10 A G 7: 43,782,880 Q79R probably benign Het
Klk6 T C 7: 43,829,275 probably null Het
Lamc2 C T 1: 153,166,263 E42K probably benign Het
Lingo3 T C 10: 80,835,721 D125G probably benign Het
Map1b T C 13: 99,432,739 N1158S unknown Het
Masp1 T A 16: 23,494,637 N183Y probably damaging Het
Mdga2 A G 12: 66,568,926 Y636H probably benign Het
Micalcl T A 7: 112,381,610 S264T probably damaging Het
Mif A G 10: 75,859,541 V95A possibly damaging Het
Mmp17 G A 5: 129,595,088 probably null Het
Mmp23 T C 4: 155,650,717 R390G possibly damaging Het
Ncoa6 A C 2: 155,415,222 S800R possibly damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nr2e3 A T 9: 59,949,205 S67R probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr1256 G A 2: 89,835,172 R258* probably null Het
Olfr172 C T 16: 58,760,853 E108K probably damaging Het
Olfr591 T A 7: 103,173,451 Y62F probably benign Het
Olfr845 C T 9: 19,338,652 S64F probably benign Het
Olfr872 A C 9: 20,260,432 Q197H possibly damaging Het
Olfr916 T G 9: 38,657,718 I225L probably damaging Het
Olfr958 A T 9: 39,550,784 V29E possibly damaging Het
Otog A T 7: 46,259,264 H562L possibly damaging Het
Pcdh15 T C 10: 74,594,191 V1250A probably damaging Het
Pde1c A G 6: 56,173,607 V309A possibly damaging Het
Pfkfb4 A C 9: 109,007,305 T134P probably damaging Het
Phc3 G T 3: 30,936,575 Q498K possibly damaging Het
Phlpp1 T C 1: 106,392,319 V1348A probably damaging Het
Pik3ap1 T C 19: 41,321,558 D441G probably damaging Het
Pkd1l2 T C 8: 117,065,500 probably null Het
Pla2g4a T C 1: 149,857,686 probably null Het
Pola2 A T 19: 5,948,406 I376N probably damaging Het
Pold2 T A 11: 5,876,833 N34Y probably damaging Het
Ppp2r5c T C 12: 110,554,886 L281P probably damaging Het
Prss46 A G 9: 110,849,635 I29V probably benign Het
Ranbp6 A T 19: 29,811,446 V502E probably benign Het
Rdh14 T C 12: 10,394,613 F155L probably damaging Het
Rnaseh2a A T 8: 84,965,858 probably null Het
Rpp30 A G 19: 36,094,385 T118A possibly damaging Het
Rragd T C 4: 32,996,005 F117L probably damaging Het
S100a2 T A 3: 90,591,292 probably null Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Sh3tc2 A G 18: 62,008,488 E1080G probably damaging Het
Slc26a9 A G 1: 131,750,677 K27R probably damaging Het
Spata17 T A 1: 187,193,994 K46N probably damaging Het
St14 A C 9: 31,108,215 D103E probably benign Het
St6galnac2 T A 11: 116,684,347 Q222L possibly damaging Het
Tdrd9 T C 12: 112,036,410 V831A probably damaging Het
Tert A G 13: 73,642,056 E843G probably damaging Het
Tex21 A G 12: 76,204,270 V464A probably benign Het
Tmem232 T A 17: 65,484,501 H124L probably damaging Het
Tmem5 A G 10: 122,090,479 W243R probably damaging Het
Tnfrsf19 T G 14: 61,005,106 S110R probably damaging Het
Tnnt3 A T 7: 142,515,825 K272* probably null Het
Tnxb T C 17: 34,711,503 L2054P probably damaging Het
Trcg1 A C 9: 57,242,465 D440A probably benign Het
Trpm3 A G 19: 22,901,221 E504G probably damaging Het
Trpm5 C T 7: 143,082,889 R437H probably benign Het
Ttn T C 2: 76,741,167 R18134G probably damaging Het
Uchl5 A C 1: 143,798,422 M64L possibly damaging Het
Urb1 G A 16: 90,753,863 R2034W probably damaging Het
Usp44 T A 10: 93,847,186 C452* probably null Het
Uvssa G A 5: 33,413,934 A641T probably damaging Het
Vmn1r204 T A 13: 22,557,078 I293N probably benign Het
Vmn2r84 A T 10: 130,389,268 C458S probably benign Het
Vmn2r85 T G 10: 130,425,919 H183P probably damaging Het
Vps13d G T 4: 145,105,861 T2825K probably benign Het
Zc3hc1 T A 6: 30,376,025 I179F probably benign Het
Zfp112 A G 7: 24,125,785 N393D probably damaging Het
Zfp558 A G 9: 18,456,563 S310P possibly damaging Het
Zfp560 A C 9: 20,348,775 probably null Het
Zfp668 C T 7: 127,867,080 E311K probably benign Het
Zfp763 T A 17: 33,033,302 M1L probably benign Het
Zfp947 A T 17: 22,145,832 M287K probably benign Het
Other mutations in Cacna1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cacna1h APN 17 25381508 missense probably damaging 1.00
IGL01412:Cacna1h APN 17 25391950 missense probably benign 0.24
IGL01625:Cacna1h APN 17 25383485 missense probably damaging 0.97
IGL01625:Cacna1h APN 17 25385712 missense possibly damaging 0.95
IGL01684:Cacna1h APN 17 25388716 missense probably damaging 1.00
IGL01862:Cacna1h APN 17 25383483 missense probably damaging 1.00
IGL01877:Cacna1h APN 17 25388050 missense probably damaging 1.00
IGL02040:Cacna1h APN 17 25397611 missense probably benign 0.10
IGL02190:Cacna1h APN 17 25433026 missense probably benign
IGL02686:Cacna1h APN 17 25385749 missense possibly damaging 0.80
IGL02883:Cacna1h APN 17 25380532 missense probably damaging 1.00
IGL02945:Cacna1h APN 17 25388059 missense probably damaging 1.00
IGL03025:Cacna1h APN 17 25432894 nonsense probably null
IGL03095:Cacna1h APN 17 25383778 unclassified probably benign
IGL03207:Cacna1h APN 17 25391333 missense probably damaging 1.00
IGL02991:Cacna1h UTSW 17 25391312 missense possibly damaging 0.56
IGL03097:Cacna1h UTSW 17 25391144 missense probably damaging 1.00
R0010:Cacna1h UTSW 17 25380844 missense probably damaging 1.00
R0194:Cacna1h UTSW 17 25380924 unclassified probably benign
R0361:Cacna1h UTSW 17 25389422 missense probably damaging 1.00
R0501:Cacna1h UTSW 17 25388667 missense probably damaging 1.00
R0558:Cacna1h UTSW 17 25381550 missense probably damaging 1.00
R0588:Cacna1h UTSW 17 25387564 missense probably damaging 1.00
R0626:Cacna1h UTSW 17 25393546 missense possibly damaging 0.92
R0811:Cacna1h UTSW 17 25388628 missense probably damaging 1.00
R0812:Cacna1h UTSW 17 25388628 missense probably damaging 1.00
R0964:Cacna1h UTSW 17 25378775 unclassified probably benign
R1351:Cacna1h UTSW 17 25391951 missense probably benign 0.14
R1457:Cacna1h UTSW 17 25397620 missense probably damaging 1.00
R1564:Cacna1h UTSW 17 25377861 nonsense probably null
R1611:Cacna1h UTSW 17 25381471 missense probably damaging 1.00
R1669:Cacna1h UTSW 17 25383471 missense probably damaging 1.00
R1835:Cacna1h UTSW 17 25392076 missense probably benign 0.01
R1858:Cacna1h UTSW 17 25380807 missense probably damaging 1.00
R1887:Cacna1h UTSW 17 25376887 missense probably benign 0.01
R2039:Cacna1h UTSW 17 25391845 missense probably benign 0.03
R2091:Cacna1h UTSW 17 25432876 missense possibly damaging 0.95
R2133:Cacna1h UTSW 17 25383528 missense probably damaging 1.00
R2203:Cacna1h UTSW 17 25380260 missense probably damaging 1.00
R2205:Cacna1h UTSW 17 25380260 missense probably damaging 1.00
R2206:Cacna1h UTSW 17 25385013 missense probably benign 0.10
R2207:Cacna1h UTSW 17 25385013 missense probably benign 0.10
R2224:Cacna1h UTSW 17 25385943 missense probably benign 0.03
R2226:Cacna1h UTSW 17 25385943 missense probably benign 0.03
R2261:Cacna1h UTSW 17 25433165 missense possibly damaging 0.91
R2361:Cacna1h UTSW 17 25384012 missense probably damaging 1.00
R2917:Cacna1h UTSW 17 25395452 missense probably damaging 0.97
R3031:Cacna1h UTSW 17 25433134 missense probably damaging 0.99
R3856:Cacna1h UTSW 17 25392453 missense probably damaging 1.00
R4230:Cacna1h UTSW 17 25387863 missense probably damaging 1.00
R4408:Cacna1h UTSW 17 25380627 missense probably damaging 1.00
R4687:Cacna1h UTSW 17 25393910 missense possibly damaging 0.47
R4887:Cacna1h UTSW 17 25377287 missense possibly damaging 0.86
R4895:Cacna1h UTSW 17 25389422 missense probably damaging 0.99
R5067:Cacna1h UTSW 17 25397808 missense probably damaging 1.00
R5077:Cacna1h UTSW 17 25375250 missense probably benign 0.02
R5148:Cacna1h UTSW 17 25387545 missense probably damaging 1.00
R5336:Cacna1h UTSW 17 25392231 missense probably damaging 0.99
R5450:Cacna1h UTSW 17 25383186 missense probably damaging 1.00
R5616:Cacna1h UTSW 17 25377667 missense probably damaging 1.00
R5738:Cacna1h UTSW 17 25387049 missense probably damaging 0.99
R5883:Cacna1h UTSW 17 25376922 missense probably benign 0.00
R5954:Cacna1h UTSW 17 25383201 missense probably damaging 1.00
R5961:Cacna1h UTSW 17 25377272 missense probably benign 0.01
R6110:Cacna1h UTSW 17 25391276 missense probably benign 0.10
R6125:Cacna1h UTSW 17 25385694 missense probably benign 0.00
R6189:Cacna1h UTSW 17 25397844 missense probably damaging 1.00
R6216:Cacna1h UTSW 17 25378819 missense probably damaging 1.00
R6259:Cacna1h UTSW 17 25397656 critical splice acceptor site probably null
R6296:Cacna1h UTSW 17 25383079 missense probably damaging 1.00
R6394:Cacna1h UTSW 17 25387481 missense probably benign 0.32
R6695:Cacna1h UTSW 17 25393740 missense probably damaging 1.00
R6746:Cacna1h UTSW 17 25381550 missense probably damaging 1.00
R6914:Cacna1h UTSW 17 25385039 missense probably benign
R6942:Cacna1h UTSW 17 25385039 missense probably benign
R6955:Cacna1h UTSW 17 25388056 missense probably damaging 1.00
R7041:Cacna1h UTSW 17 25394003 missense probably damaging 0.98
R7120:Cacna1h UTSW 17 25391507 missense probably benign 0.31
R7125:Cacna1h UTSW 17 25383536 missense probably damaging 0.99
R7182:Cacna1h UTSW 17 25377655 missense probably damaging 1.00
R7270:Cacna1h UTSW 17 25384765 missense probably damaging 1.00
R7274:Cacna1h UTSW 17 25378837 missense probably damaging 1.00
R7319:Cacna1h UTSW 17 25389461 missense possibly damaging 0.94
R7406:Cacna1h UTSW 17 25385626 missense possibly damaging 0.56
R7634:Cacna1h UTSW 17 25392109 missense possibly damaging 0.87
R7684:Cacna1h UTSW 17 25389372 missense probably damaging 0.99
R7769:Cacna1h UTSW 17 25385805 missense probably damaging 1.00
R7856:Cacna1h UTSW 17 25389477 missense probably damaging 0.98
R7876:Cacna1h UTSW 17 25375251 missense probably benign
R7898:Cacna1h UTSW 17 25392276 missense probably damaging 1.00
R8038:Cacna1h UTSW 17 25375891 missense probably damaging 0.97
R8042:Cacna1h UTSW 17 25392471 nonsense probably null
R8139:Cacna1h UTSW 17 25383723 missense probably damaging 1.00
R8391:Cacna1h UTSW 17 25377230 missense probably benign 0.00
R8795:Cacna1h UTSW 17 25393564 missense probably damaging 1.00
R9227:Cacna1h UTSW 17 25380882 missense probably damaging 1.00
R9230:Cacna1h UTSW 17 25380882 missense probably damaging 1.00
R9236:Cacna1h UTSW 17 25381450 missense probably damaging 1.00
R9360:Cacna1h UTSW 17 25375362 missense probably benign 0.00
R9476:Cacna1h UTSW 17 25392550 missense probably damaging 1.00
R9567:Cacna1h UTSW 17 25393513 missense not run
V1662:Cacna1h UTSW 17 25377309 missense possibly damaging 0.68
Z1176:Cacna1h UTSW 17 25391250 missense probably benign
Z1177:Cacna1h UTSW 17 25375892 missense probably damaging 1.00
Z1177:Cacna1h UTSW 17 25391378 missense probably damaging 0.99
Z1177:Cacna1h UTSW 17 25393584 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCCAGGTGCTATGCAAACGAGGAG -3'
(R):5'- GGACTGTTCGGCCAGAAATGCTAC -3'

Sequencing Primer
(F):5'- CTGGGACTACCCTAGAAAGGC -3'
(R):5'- AACAGGCTGGACTTCTTCATTG -3'
Posted On 2014-04-13