Incidental Mutation 'R1517:Coq10b'
ID 167071
Institutional Source Beutler Lab
Gene Symbol Coq10b
Ensembl Gene ENSMUSG00000025981
Gene Name coenzyme Q10B
Synonyms 1700030I21Rik, 9530077A17Rik, 1500041J02Rik
MMRRC Submission 039563-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R1517 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 55091929-55111861 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55103416 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 65 (S65P)
Ref Sequence ENSEMBL: ENSMUSP00000084899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027125] [ENSMUST00000087617]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027125
AA Change: S115P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027125
Gene: ENSMUSG00000025981
AA Change: S115P

DomainStartEndE-ValueType
Pfam:Polyketide_cyc 88 217 2.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087617
AA Change: S65P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084899
Gene: ENSMUSG00000025981
AA Change: S65P

DomainStartEndE-ValueType
Pfam:Polyketide_cyc 38 167 4.7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190239
Meta Mutation Damage Score 0.9727 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,862,640 (GRCm39) K375R possibly damaging Het
Adrb2 T C 18: 62,311,871 (GRCm39) N318S probably damaging Het
Akap5 A C 12: 76,376,036 (GRCm39) E489D possibly damaging Het
Aldh7a1 T A 18: 56,665,133 (GRCm39) I385F probably damaging Het
Astn1 T A 1: 158,407,146 (GRCm39) probably benign Het
Atp7b T A 8: 22,487,374 (GRCm39) T1314S probably damaging Het
Bhmt2 C A 13: 93,798,847 (GRCm39) G325C probably damaging Het
Brpf1 T A 6: 113,296,050 (GRCm39) V781E probably benign Het
Cacna1c T A 6: 118,575,720 (GRCm39) Y1860F probably benign Het
Ccdc7a T C 8: 129,788,162 (GRCm39) T56A probably damaging Het
Cep78 A G 19: 15,937,027 (GRCm39) S560P probably damaging Het
Cnot1 G A 8: 96,469,841 (GRCm39) T1343I probably benign Het
Creld1 T A 6: 113,466,745 (GRCm39) C243S probably damaging Het
Cst12 A T 2: 148,635,172 (GRCm39) I121F possibly damaging Het
Cyp26a1 A C 19: 37,687,308 (GRCm39) E165A probably benign Het
Cyp2d12 T G 15: 82,442,337 (GRCm39) M273R probably damaging Het
Dnajb7 T A 15: 81,291,657 (GRCm39) S227C probably damaging Het
Evc T A 5: 37,476,379 (GRCm39) Q390L probably damaging Het
F830016B08Rik T A 18: 60,433,970 (GRCm39) L351* probably null Het
Fga T C 3: 82,939,145 (GRCm39) S507P probably benign Het
Gba1 A T 3: 89,113,455 (GRCm39) Y239F probably damaging Het
Golga2 C A 2: 32,195,996 (GRCm39) Y843* probably null Het
Gria4 C A 9: 4,793,865 (GRCm39) L64F probably damaging Het
Hectd3 A G 4: 116,860,191 (GRCm39) Y803C probably damaging Het
Hmcn1 T C 1: 150,545,172 (GRCm39) K2812E probably damaging Het
Il17b T G 18: 61,823,316 (GRCm39) V50G probably damaging Het
Itga2b A T 11: 102,357,151 (GRCm39) L243* probably null Het
Kank4 C A 4: 98,667,266 (GRCm39) V394L possibly damaging Het
Kat14 T A 2: 144,215,711 (GRCm39) D65E probably benign Het
Kcnh3 T C 15: 99,136,090 (GRCm39) Y696H probably damaging Het
Kctd19 C A 8: 106,122,008 (GRCm39) D180Y probably damaging Het
Klra8 A C 6: 130,092,603 (GRCm39) S233A probably benign Het
Masp2 A T 4: 148,696,563 (GRCm39) T387S possibly damaging Het
Midn C A 10: 79,989,957 (GRCm39) T275N probably damaging Het
Mis18bp1 A G 12: 65,180,587 (GRCm39) F965L probably benign Het
Myo3a G T 2: 22,287,445 (GRCm39) V186L probably damaging Het
Ncoa2 T A 1: 13,235,281 (GRCm39) N884I probably benign Het
Or10d4 T C 9: 39,581,016 (GRCm39) I221T probably damaging Het
Or13c25 A T 4: 52,911,502 (GRCm39) C97* probably null Het
Or8k35 T A 2: 86,424,948 (GRCm39) T75S probably damaging Het
Osr2 T C 15: 35,300,813 (GRCm39) V123A probably benign Het
P4ha2 A G 11: 54,008,471 (GRCm39) H226R probably benign Het
Pcdhb16 T A 18: 37,611,151 (GRCm39) V37E probably benign Het
Pcdhb18 T A 18: 37,622,673 (GRCm39) M1K probably null Het
Pcsk1 T A 13: 75,246,166 (GRCm39) Y181* probably null Het
Pros1 G T 16: 62,705,875 (GRCm39) C63F probably damaging Het
Ranbp3l T A 15: 9,065,081 (GRCm39) C353* probably null Het
Rev3l T C 10: 39,714,439 (GRCm39) Y2388H probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rpl12-ps1 G T 1: 36,997,458 (GRCm39) noncoding transcript Het
Rttn T C 18: 89,131,474 (GRCm39) V1951A probably benign Het
Scn9a G A 2: 66,335,371 (GRCm39) probably benign Het
Sdk1 T C 5: 142,113,591 (GRCm39) F1546S probably damaging Het
Sh3glb2 C T 2: 30,244,987 (GRCm39) R71Q probably damaging Het
Slc30a6 T C 17: 74,715,842 (GRCm39) F101L probably benign Het
Snrpd1 T C 18: 10,626,913 (GRCm39) I60T probably damaging Het
Sox10 T A 15: 79,043,378 (GRCm39) E218D probably benign Het
Tekt3 C A 11: 62,961,316 (GRCm39) H162N probably damaging Het
Tnfsf13 T C 11: 69,575,564 (GRCm39) S246G possibly damaging Het
Trim10 T A 17: 37,183,346 (GRCm39) I214N probably damaging Het
Trp63 C A 16: 25,708,003 (GRCm39) D566E probably damaging Het
Uck2 T C 1: 167,062,293 (GRCm39) D156G probably damaging Het
Zfp386 T A 12: 116,023,225 (GRCm39) S314R possibly damaging Het
Zfp467 C T 6: 48,415,170 (GRCm39) R494H probably damaging Het
Zfp735 A T 11: 73,601,470 (GRCm39) D138V probably benign Het
Zfyve26 T C 12: 79,298,925 (GRCm39) E445G probably damaging Het
Other mutations in Coq10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Coq10b APN 1 55,100,468 (GRCm39) missense probably benign
IGL00697:Coq10b APN 1 55,100,424 (GRCm39) splice site probably null
R1751:Coq10b UTSW 1 55,100,513 (GRCm39) missense probably damaging 0.99
R1767:Coq10b UTSW 1 55,100,513 (GRCm39) missense probably damaging 0.99
R2195:Coq10b UTSW 1 55,100,457 (GRCm39) missense probably damaging 1.00
R2421:Coq10b UTSW 1 55,092,136 (GRCm39) missense probably benign 0.00
R4796:Coq10b UTSW 1 55,110,957 (GRCm39) missense probably damaging 1.00
R4851:Coq10b UTSW 1 55,110,903 (GRCm39) missense probably benign 0.13
R5367:Coq10b UTSW 1 55,092,143 (GRCm39) missense probably benign
R5534:Coq10b UTSW 1 55,103,359 (GRCm39) missense possibly damaging 0.83
R5979:Coq10b UTSW 1 55,092,077 (GRCm39) missense probably benign 0.00
R7402:Coq10b UTSW 1 55,100,500 (GRCm39) missense probably benign 0.00
R7836:Coq10b UTSW 1 55,092,013 (GRCm39) start gained probably benign
R7931:Coq10b UTSW 1 55,092,152 (GRCm39) splice site probably benign
R9292:Coq10b UTSW 1 55,110,868 (GRCm39) missense probably damaging 1.00
R9426:Coq10b UTSW 1 55,106,719 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AGTACCCCTGAGGTTCCAGTTGTG -3'
(R):5'- TCTCTTCTGTGGGCCAGATGATCTATC -3'

Sequencing Primer
(F):5'- AGGTTCCAGTTGTGACCTCTG -3'
(R):5'- CAGATGATCTATCTGGTGATCTAGC -3'
Posted On 2014-04-13