Incidental Mutation 'R1517:Astn1'
ID167073
Institutional Source Beutler Lab
Gene Symbol Astn1
Ensembl Gene ENSMUSG00000026587
Gene Nameastrotactin 1
Synonyms
MMRRC Submission 039563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R1517 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location158362273-158691781 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 158579576 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000170718] [ENSMUST00000193042] [ENSMUST00000193599] [ENSMUST00000194369] [ENSMUST00000195311]
Predicted Effect probably benign
Transcript: ENSMUST00000046110
SMART Domains Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170718
SMART Domains Protein: ENSMUSP00000127428
Gene: ENSMUSG00000026587

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
Blast:MACPF 811 835 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193042
SMART Domains Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193599
SMART Domains Protein: ENSMUSP00000141498
Gene: ENSMUSG00000026587

DomainStartEndE-ValueType
EGF 101 142 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194369
SMART Domains Protein: ENSMUSP00000142017
Gene: ENSMUSG00000026587

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 499 2e-2 SMART
EGF 603 644 1.1e-1 SMART
EGF_like 651 700 1.7e-1 SMART
Blast:MACPF 803 828 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195311
SMART Domains Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 499 2e-2 SMART
EGF 603 644 1.1e-1 SMART
EGF_like 651 700 1.7e-1 SMART
MACPF 803 991 6.2e-59 SMART
FN3 1022 1134 2.8e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,971,814 K375R possibly damaging Het
Adrb2 T C 18: 62,178,800 N318S probably damaging Het
Akap5 A C 12: 76,329,262 E489D possibly damaging Het
Aldh7a1 T A 18: 56,532,061 I385F probably damaging Het
Atp7b T A 8: 21,997,358 T1314S probably damaging Het
Bhmt2 C A 13: 93,662,339 G325C probably damaging Het
Brpf1 T A 6: 113,319,089 V781E probably benign Het
Cacna1c T A 6: 118,598,759 Y1860F probably benign Het
Ccdc7a T C 8: 129,061,681 T56A probably damaging Het
Cep78 A G 19: 15,959,663 S560P probably damaging Het
Cnot1 G A 8: 95,743,213 T1343I probably benign Het
Coq10b T C 1: 55,064,257 S65P probably damaging Het
Creld1 T A 6: 113,489,784 C243S probably damaging Het
Cst12 A T 2: 148,793,252 I121F possibly damaging Het
Cyp26a1 A C 19: 37,698,860 E165A probably benign Het
Cyp2d12 T G 15: 82,558,136 M273R probably damaging Het
Dnajb7 T A 15: 81,407,456 S227C probably damaging Het
Evc T A 5: 37,319,035 Q390L probably damaging Het
F830016B08Rik T A 18: 60,300,898 L351* probably null Het
Fga T C 3: 83,031,838 S507P probably benign Het
Gba A T 3: 89,206,148 Y239F probably damaging Het
Golga2 C A 2: 32,305,984 Y843* probably null Het
Gria4 C A 9: 4,793,865 L64F probably damaging Het
Hectd3 A G 4: 117,002,994 Y803C probably damaging Het
Hmcn1 T C 1: 150,669,421 K2812E probably damaging Het
Il17b T G 18: 61,690,245 V50G probably damaging Het
Itga2b A T 11: 102,466,325 L243* probably null Het
Kank4 C A 4: 98,779,029 V394L possibly damaging Het
Kat14 T A 2: 144,373,791 D65E probably benign Het
Kcnh3 T C 15: 99,238,209 Y696H probably damaging Het
Kctd19 C A 8: 105,395,376 D180Y probably damaging Het
Klra8 A C 6: 130,115,640 S233A probably benign Het
Masp2 A T 4: 148,612,106 T387S possibly damaging Het
Midn C A 10: 80,154,123 T275N probably damaging Het
Mis18bp1 A G 12: 65,133,813 F965L probably benign Het
Myo3a G T 2: 22,282,634 V186L probably damaging Het
Ncoa2 T A 1: 13,165,057 N884I probably benign Het
Olfr1082 T A 2: 86,594,604 T75S probably damaging Het
Olfr272 A T 4: 52,911,502 C97* probably null Het
Olfr963 T C 9: 39,669,720 I221T probably damaging Het
Osr2 T C 15: 35,300,667 V123A probably benign Het
P4ha2 A G 11: 54,117,645 H226R probably benign Het
Pcdhb16 T A 18: 37,478,098 V37E probably benign Het
Pcdhb18 T A 18: 37,489,620 M1K probably null Het
Pcsk1 T A 13: 75,098,047 Y181* probably null Het
Pros1 G T 16: 62,885,512 C63F probably damaging Het
Ranbp3l T A 15: 9,065,001 C353* probably null Het
Rev3l T C 10: 39,838,443 Y2388H probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl12-ps1 G T 1: 36,958,377 noncoding transcript Het
Rttn T C 18: 89,113,350 V1951A probably benign Het
Scn9a G A 2: 66,505,027 probably benign Het
Sdk1 T C 5: 142,127,836 F1546S probably damaging Het
Sh3glb2 C T 2: 30,354,975 R71Q probably damaging Het
Slc30a6 T C 17: 74,408,847 F101L probably benign Het
Snrpd1 T C 18: 10,626,913 I60T probably damaging Het
Sox10 T A 15: 79,159,178 E218D probably benign Het
Tekt3 C A 11: 63,070,490 H162N probably damaging Het
Tnfsf13 T C 11: 69,684,738 S246G possibly damaging Het
Trim10 T A 17: 36,872,454 I214N probably damaging Het
Trp63 C A 16: 25,889,253 D566E probably damaging Het
Uck2 T C 1: 167,234,724 D156G probably damaging Het
Zfp386 T A 12: 116,059,605 S314R possibly damaging Het
Zfp467 C T 6: 48,438,236 R494H probably damaging Het
Zfp735 A T 11: 73,710,644 D138V probably benign Het
Zfyve26 T C 12: 79,252,151 E445G probably damaging Het
Other mutations in Astn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Astn1 APN 1 158600319 missense possibly damaging 0.71
IGL01705:Astn1 APN 1 158504313 missense probably damaging 1.00
IGL01790:Astn1 APN 1 158580327 missense possibly damaging 0.70
IGL01962:Astn1 APN 1 158668631 missense probably damaging 1.00
IGL02000:Astn1 APN 1 158674614 missense probably damaging 1.00
IGL02119:Astn1 APN 1 158511154 intron probably benign
IGL02168:Astn1 APN 1 158609341 missense possibly damaging 0.93
IGL02239:Astn1 APN 1 158664130 critical splice donor site probably null
IGL02271:Astn1 APN 1 158510950 splice site probably benign
IGL02307:Astn1 APN 1 158674614 missense probably damaging 1.00
IGL02504:Astn1 APN 1 158502408 missense probably damaging 1.00
IGL02552:Astn1 APN 1 158505395 missense possibly damaging 0.90
IGL02903:Astn1 APN 1 158688550 missense probably damaging 0.99
IGL03003:Astn1 APN 1 158612395 missense probably benign 0.00
IGL03007:Astn1 APN 1 158668623 splice site probably benign
IGL03354:Astn1 APN 1 158688604 missense probably damaging 1.00
PIT4366001:Astn1 UTSW 1 158597209 missense probably benign 0.20
PIT4366001:Astn1 UTSW 1 158597211 missense probably benign 0.23
R0024:Astn1 UTSW 1 158684215 missense probably damaging 0.99
R0050:Astn1 UTSW 1 158579724 splice site probably benign
R0099:Astn1 UTSW 1 158502151 missense probably damaging 1.00
R0109:Astn1 UTSW 1 158664104 missense possibly damaging 0.79
R0109:Astn1 UTSW 1 158664104 missense possibly damaging 0.79
R0365:Astn1 UTSW 1 158688548 missense probably damaging 1.00
R0416:Astn1 UTSW 1 158509891 missense probably damaging 1.00
R0531:Astn1 UTSW 1 158600389 missense probably damaging 0.99
R0735:Astn1 UTSW 1 158472389 missense possibly damaging 0.53
R0763:Astn1 UTSW 1 158509890 missense possibly damaging 0.93
R0899:Astn1 UTSW 1 158511109 nonsense probably null
R1027:Astn1 UTSW 1 158580279 missense probably damaging 1.00
R1160:Astn1 UTSW 1 158600365 missense possibly damaging 0.83
R1474:Astn1 UTSW 1 158502353 missense probably damaging 1.00
R1701:Astn1 UTSW 1 158504307 missense possibly damaging 0.54
R1764:Astn1 UTSW 1 158504251 missense probably benign 0.35
R1860:Astn1 UTSW 1 158601945 missense probably damaging 1.00
R1889:Astn1 UTSW 1 158505316 intron probably null
R1919:Astn1 UTSW 1 158509971 missense probably damaging 1.00
R2001:Astn1 UTSW 1 158520521 missense probably damaging 1.00
R2007:Astn1 UTSW 1 158609305 missense probably damaging 0.97
R2038:Astn1 UTSW 1 158657120 missense probably benign 0.29
R2044:Astn1 UTSW 1 158600502 missense possibly damaging 0.53
R2084:Astn1 UTSW 1 158472408 missense probably damaging 0.99
R2094:Astn1 UTSW 1 158667609 missense probably benign 0.02
R2163:Astn1 UTSW 1 158502150 missense probably damaging 0.99
R2211:Astn1 UTSW 1 158657306 missense probably benign 0.40
R2268:Astn1 UTSW 1 158502099 missense probably damaging 1.00
R2269:Astn1 UTSW 1 158502099 missense probably damaging 1.00
R2425:Astn1 UTSW 1 158579666 missense probably damaging 0.99
R2428:Astn1 UTSW 1 158612346 missense possibly damaging 0.66
R2980:Astn1 UTSW 1 158572951 critical splice acceptor site probably null
R3713:Astn1 UTSW 1 158667532 missense possibly damaging 0.83
R3745:Astn1 UTSW 1 158502060 missense probably damaging 1.00
R3926:Astn1 UTSW 1 158579657 missense possibly damaging 0.95
R4345:Astn1 UTSW 1 158502032 intron probably null
R4625:Astn1 UTSW 1 158580294 missense probably damaging 1.00
R4627:Astn1 UTSW 1 158502251 missense possibly damaging 0.55
R4970:Astn1 UTSW 1 158657193 missense possibly damaging 0.88
R5112:Astn1 UTSW 1 158657193 missense possibly damaging 0.88
R5257:Astn1 UTSW 1 158612532 missense probably damaging 1.00
R5292:Astn1 UTSW 1 158580363 critical splice donor site probably null
R5889:Astn1 UTSW 1 158600380 missense possibly damaging 0.93
R5909:Astn1 UTSW 1 158601937 missense probably damaging 1.00
R6020:Astn1 UTSW 1 158509993 missense probably damaging 1.00
R6349:Astn1 UTSW 1 158664121 nonsense probably null
R6481:Astn1 UTSW 1 158612462 missense probably benign 0.29
R6736:Astn1 UTSW 1 158511148 critical splice donor site probably null
R6833:Astn1 UTSW 1 158664122 missense probably benign 0.40
R6834:Astn1 UTSW 1 158664122 missense probably benign 0.40
R6860:Astn1 UTSW 1 158612472 missense probably damaging 1.00
R6874:Astn1 UTSW 1 158664074 nonsense probably null
R7062:Astn1 UTSW 1 158688511 critical splice acceptor site probably null
R7133:Astn1 UTSW 1 158572987 missense probably damaging 1.00
R7355:Astn1 UTSW 1 158664276 intron probably null
R7402:Astn1 UTSW 1 158552855 intron probably benign
R7412:Astn1 UTSW 1 158502349 missense probably damaging 0.98
R7537:Astn1 UTSW 1 158505386 missense possibly damaging 0.84
R7537:Astn1 UTSW 1 158667638 splice site probably null
R7635:Astn1 UTSW 1 158667535 nonsense probably null
Z1088:Astn1 UTSW 1 158472497 missense possibly damaging 0.93
Z1088:Astn1 UTSW 1 158597206 missense possibly damaging 0.91
Z1088:Astn1 UTSW 1 158684096 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTTCAGGGAGAAACTCTGGCTGC -3'
(R):5'- GCTTGCCAAGTTCAGCTTGCTC -3'

Sequencing Primer
(F):5'- GCCATTTCTAATGGACAAATGGGTC -3'
(R):5'- AAGTTCAGCTTGCTCTACCTC -3'
Posted On2014-04-13