Mutagenetix > Incidental Mutation

Incidental Mutation 'R1517:Rif1'

167079

Institutional Source

Beutler Lab

Gene Symbol

Rif1

Ensembl Gene

ENSMUSG00000036202

Gene Name

replication timing regulatory factor 1

Synonyms

6530403D07Rik, 5730435J01Rik, D2Ertd145e

MMRRC Submission

039563-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1517 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

52072832-52122383 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

GCCACCA to GCCA at 52110324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000069794
AA Change: 1264

SMART Domains

Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: 1264

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	22	368	3.3e-78	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112693
AA Change: P1264

SMART Domains

Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: P1264

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	18	381	1.4e-85	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125322

Predicted Effect

probably benign
Transcript: ENSMUST00000125376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145130

Predicted Effect

probably benign
Transcript: ENSMUST00000152178

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.9%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	C	11: 109,971,814	K375R	possibly damaging	Het
Adrb2	T	C	18: 62,178,800	N318S	probably damaging	Het
Akap5	A	C	12: 76,329,262	E489D	possibly damaging	Het
Aldh7a1	T	A	18: 56,532,061	I385F	probably damaging	Het
Astn1	T	A	1: 158,579,576		probably benign	Het
Atp7b	T	A	8: 21,997,358	T1314S	probably damaging	Het
Bhmt2	C	A	13: 93,662,339	G325C	probably damaging	Het
Brpf1	T	A	6: 113,319,089	V781E	probably benign	Het
Cacna1c	T	A	6: 118,598,759	Y1860F	probably benign	Het
Ccdc7a	T	C	8: 129,061,681	T56A	probably damaging	Het
Cep78	A	G	19: 15,959,663	S560P	probably damaging	Het
Cnot1	G	A	8: 95,743,213	T1343I	probably benign	Het
Coq10b	T	C	1: 55,064,257	S65P	probably damaging	Het
Creld1	T	A	6: 113,489,784	C243S	probably damaging	Het
Cst12	A	T	2: 148,793,252	I121F	possibly damaging	Het
Cyp26a1	A	C	19: 37,698,860	E165A	probably benign	Het
Cyp2d12	T	G	15: 82,558,136	M273R	probably damaging	Het
Dnajb7	T	A	15: 81,407,456	S227C	probably damaging	Het
Evc	T	A	5: 37,319,035	Q390L	probably damaging	Het
F830016B08Rik	T	A	18: 60,300,898	L351*	probably null	Het
Fga	T	C	3: 83,031,838	S507P	probably benign	Het
Gba	A	T	3: 89,206,148	Y239F	probably damaging	Het
Golga2	C	A	2: 32,305,984	Y843*	probably null	Het
Gria4	C	A	9: 4,793,865	L64F	probably damaging	Het
Hectd3	A	G	4: 117,002,994	Y803C	probably damaging	Het
Hmcn1	T	C	1: 150,669,421	K2812E	probably damaging	Het
Il17b	T	G	18: 61,690,245	V50G	probably damaging	Het
Itga2b	A	T	11: 102,466,325	L243*	probably null	Het
Kank4	C	A	4: 98,779,029	V394L	possibly damaging	Het
Kat14	T	A	2: 144,373,791	D65E	probably benign	Het
Kcnh3	T	C	15: 99,238,209	Y696H	probably damaging	Het
Kctd19	C	A	8: 105,395,376	D180Y	probably damaging	Het
Klra8	A	C	6: 130,115,640	S233A	probably benign	Het
Masp2	A	T	4: 148,612,106	T387S	possibly damaging	Het
Midn	C	A	10: 80,154,123	T275N	probably damaging	Het
Mis18bp1	A	G	12: 65,133,813	F965L	probably benign	Het
Myo3a	G	T	2: 22,282,634	V186L	probably damaging	Het
Ncoa2	T	A	1: 13,165,057	N884I	probably benign	Het
Olfr1082	T	A	2: 86,594,604	T75S	probably damaging	Het
Olfr272	A	T	4: 52,911,502	C97*	probably null	Het
Olfr963	T	C	9: 39,669,720	I221T	probably damaging	Het
Osr2	T	C	15: 35,300,667	V123A	probably benign	Het
P4ha2	A	G	11: 54,117,645	H226R	probably benign	Het
Pcdhb16	T	A	18: 37,478,098	V37E	probably benign	Het
Pcdhb18	T	A	18: 37,489,620	M1K	probably null	Het
Pcsk1	T	A	13: 75,098,047	Y181*	probably null	Het
Pros1	G	T	16: 62,885,512	C63F	probably damaging	Het
Ranbp3l	T	A	15: 9,065,001	C353*	probably null	Het
Rev3l	T	C	10: 39,838,443	Y2388H	probably benign	Het
Rpl12-ps1	G	T	1: 36,958,377		noncoding transcript	Het
Rttn	T	C	18: 89,113,350	V1951A	probably benign	Het
Scn9a	G	A	2: 66,505,027		probably benign	Het
Sdk1	T	C	5: 142,127,836	F1546S	probably damaging	Het
Sh3glb2	C	T	2: 30,354,975	R71Q	probably damaging	Het
Slc30a6	T	C	17: 74,408,847	F101L	probably benign	Het
Snrpd1	T	C	18: 10,626,913	I60T	probably damaging	Het
Sox10	T	A	15: 79,159,178	E218D	probably benign	Het
Tekt3	C	A	11: 63,070,490	H162N	probably damaging	Het
Tnfsf13	T	C	11: 69,684,738	S246G	possibly damaging	Het
Trim10	T	A	17: 36,872,454	I214N	probably damaging	Het
Trp63	C	A	16: 25,889,253	D566E	probably damaging	Het
Uck2	T	C	1: 167,234,724	D156G	probably damaging	Het
Zfp386	T	A	12: 116,059,605	S314R	possibly damaging	Het
Zfp467	C	T	6: 48,438,236	R494H	probably damaging	Het
Zfp735	A	T	11: 73,710,644	D138V	probably benign	Het
Zfyve26	T	C	12: 79,252,151	E445G	probably damaging	Het

Other mutations in Rif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Rif1	APN	2	52121007	missense	probably damaging	0.96
IGL00711:Rif1	APN	2	52111070	missense	probably benign	0.00
IGL00721:Rif1	APN	2	52119117	missense	probably damaging	1.00
IGL01085:Rif1	APN	2	52085140	missense	possibly damaging	0.71
IGL01093:Rif1	APN	2	52095948	missense	probably damaging	1.00
IGL01107:Rif1	APN	2	52111303	missense	probably benign	0.00
IGL01138:Rif1	APN	2	52111522	missense	probably damaging	1.00
IGL01844:Rif1	APN	2	52112543	missense	probably benign	0.07
IGL02441:Rif1	APN	2	52105515	missense	probably benign	0.00
IGL02448:Rif1	APN	2	52116696	missense	probably damaging	0.99
IGL02563:Rif1	APN	2	52077065	missense	probably damaging	1.00
IGL02704:Rif1	APN	2	52093576	missense	probably damaging	1.00
IGL02946:Rif1	APN	2	52110125	nonsense	probably null
IGL03060:Rif1	APN	2	52112137	missense	probably damaging	0.97
IGL03206:Rif1	APN	2	52103622	missense	probably damaging	1.00
IGL03263:Rif1	APN	2	52090261	missense	probably damaging	0.99
IGL03267:Rif1	APN	2	52076988	missense	possibly damaging	0.94
IGL03280:Rif1	APN	2	52112599	missense	probably benign	0.32
hifi	UTSW	2	52110324	unclassified	probably benign
nietzsche	UTSW	2	52077020	missense	probably benign	0.08
PIT4305001:Rif1	UTSW	2	52111958	missense
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0104:Rif1	UTSW	2	52110092	missense	possibly damaging	0.77
R0268:Rif1	UTSW	2	52090286	critical splice donor site	probably null
R0276:Rif1	UTSW	2	52110324	unclassified	probably benign
R0278:Rif1	UTSW	2	52110324	unclassified	probably benign
R0288:Rif1	UTSW	2	52110013	missense	probably damaging	1.00
R0314:Rif1	UTSW	2	52110324	unclassified	probably benign
R0345:Rif1	UTSW	2	52110324	unclassified	probably benign
R0346:Rif1	UTSW	2	52110324	unclassified	probably benign
R0383:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R0384:Rif1	UTSW	2	52110324	unclassified	probably benign
R0387:Rif1	UTSW	2	52110324	unclassified	probably benign
R0388:Rif1	UTSW	2	52110324	unclassified	probably benign
R0456:Rif1	UTSW	2	52110324	unclassified	probably benign
R0477:Rif1	UTSW	2	52110324	unclassified	probably benign
R0505:Rif1	UTSW	2	52110737	missense	probably damaging	0.99
R0510:Rif1	UTSW	2	52110324	unclassified	probably benign
R0511:Rif1	UTSW	2	52110324	unclassified	probably benign
R0512:Rif1	UTSW	2	52110324	unclassified	probably benign
R0633:Rif1	UTSW	2	52112563	missense	probably benign	0.00
R0637:Rif1	UTSW	2	52110324	unclassified	probably benign
R0638:Rif1	UTSW	2	52111588	missense	probably benign	0.12
R0666:Rif1	UTSW	2	52110324	unclassified	probably benign
R0675:Rif1	UTSW	2	52110324	unclassified	probably benign
R0707:Rif1	UTSW	2	52110324	unclassified	probably benign
R0726:Rif1	UTSW	2	52110353	missense	possibly damaging	0.52
R0743:Rif1	UTSW	2	52110324	unclassified	probably benign
R0744:Rif1	UTSW	2	52110324	unclassified	probably benign
R0938:Rif1	UTSW	2	52110324	unclassified	probably benign
R0939:Rif1	UTSW	2	52110324	unclassified	probably benign
R0940:Rif1	UTSW	2	52110324	unclassified	probably benign
R0941:Rif1	UTSW	2	52110324	unclassified	probably benign
R0942:Rif1	UTSW	2	52110324	unclassified	probably benign
R0943:Rif1	UTSW	2	52110324	unclassified	probably benign
R1006:Rif1	UTSW	2	52085029	missense	probably damaging	0.99
R1052:Rif1	UTSW	2	52111562	missense	probably benign	0.01
R1061:Rif1	UTSW	2	52110324	unclassified	probably benign
R1175:Rif1	UTSW	2	52107628	unclassified	probably benign
R1183:Rif1	UTSW	2	52110324	unclassified	probably benign
R1184:Rif1	UTSW	2	52110324	unclassified	probably benign
R1271:Rif1	UTSW	2	52110324	unclassified	probably benign
R1332:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1336:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1351:Rif1	UTSW	2	52111555	missense	possibly damaging	0.74
R1527:Rif1	UTSW	2	52110324	unclassified	probably benign
R1560:Rif1	UTSW	2	52111131	missense	probably damaging	1.00
R1563:Rif1	UTSW	2	52073223	missense	probably damaging	0.99
R1571:Rif1	UTSW	2	52110324	unclassified	probably benign
R1625:Rif1	UTSW	2	52103640	missense	probably benign	0.25
R1679:Rif1	UTSW	2	52110324	unclassified	probably benign
R1689:Rif1	UTSW	2	52110324	unclassified	probably benign
R1731:Rif1	UTSW	2	52110324	unclassified	probably benign
R1744:Rif1	UTSW	2	52112392	missense	possibly damaging	0.56
R1746:Rif1	UTSW	2	52110324	unclassified	probably benign
R1748:Rif1	UTSW	2	52110324	unclassified	probably benign
R1831:Rif1	UTSW	2	52078495	nonsense	probably null
R1902:Rif1	UTSW	2	52116673	missense	possibly damaging	0.93
R1964:Rif1	UTSW	2	52098409	missense	probably benign	0.01
R1978:Rif1	UTSW	2	52110324	unclassified	probably benign
R2000:Rif1	UTSW	2	52081298	missense	probably damaging	0.99
R2030:Rif1	UTSW	2	52092346	missense	probably damaging	1.00
R2056:Rif1	UTSW	2	52093576	missense	probably damaging	1.00
R2106:Rif1	UTSW	2	52110324	unclassified	probably benign
R2109:Rif1	UTSW	2	52110324	unclassified	probably benign
R2125:Rif1	UTSW	2	52110324	unclassified	probably benign
R2126:Rif1	UTSW	2	52110324	unclassified	probably benign
R2145:Rif1	UTSW	2	52111400	missense	possibly damaging	0.63
R2152:Rif1	UTSW	2	52110324	unclassified	probably benign
R2153:Rif1	UTSW	2	52110324	unclassified	probably benign
R2213:Rif1	UTSW	2	52110324	unclassified	probably benign
R2327:Rif1	UTSW	2	52110324	unclassified	probably benign
R2512:Rif1	UTSW	2	52110324	unclassified	probably benign
R2513:Rif1	UTSW	2	52110324	unclassified	probably benign
R2516:Rif1	UTSW	2	52110324	unclassified	probably benign
R2520:Rif1	UTSW	2	52110324	unclassified	probably benign
R2905:Rif1	UTSW	2	52098504	missense	probably damaging	0.99
R3005:Rif1	UTSW	2	52082764	missense	probably damaging	1.00
R3155:Rif1	UTSW	2	52110324	unclassified	probably benign
R3156:Rif1	UTSW	2	52110324	unclassified	probably benign
R3429:Rif1	UTSW	2	52110324	unclassified	probably benign
R3707:Rif1	UTSW	2	52093580	missense	probably damaging	1.00
R3907:Rif1	UTSW	2	52112545	missense	probably benign	0.03
R3978:Rif1	UTSW	2	52116747	critical splice donor site	probably null
R4023:Rif1	UTSW	2	52121087	missense	probably benign	0.01
R4052:Rif1	UTSW	2	52098471	nonsense	probably null
R4668:Rif1	UTSW	2	52111952	missense	probably benign	0.01
R4674:Rif1	UTSW	2	52106942	missense	probably null	1.00
R4715:Rif1	UTSW	2	52073139	utr 5 prime	probably benign
R4766:Rif1	UTSW	2	52098934	missense	probably damaging	1.00
R4783:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4785:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4869:Rif1	UTSW	2	52093611	intron	probably benign
R4911:Rif1	UTSW	2	52110518	missense	probably damaging	0.98
R4951:Rif1	UTSW	2	52084986	splice site	probably null
R5044:Rif1	UTSW	2	52109928	missense	probably damaging	0.99
R5088:Rif1	UTSW	2	52092295	missense	possibly damaging	0.91
R5151:Rif1	UTSW	2	52120309	missense	probably damaging	1.00
R5187:Rif1	UTSW	2	52081289	missense	probably damaging	1.00
R5222:Rif1	UTSW	2	52077020	missense	probably benign	0.08
R5243:Rif1	UTSW	2	52111824	missense	possibly damaging	0.86
R5436:Rif1	UTSW	2	52120971	intron	probably benign
R5476:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
R5496:Rif1	UTSW	2	52098916	missense	probably damaging	1.00
R5641:Rif1	UTSW	2	52121158	missense	possibly damaging	0.80
R5883:Rif1	UTSW	2	52105639	critical splice donor site	probably null
R5987:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5990:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5992:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6019:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6020:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6255:Rif1	UTSW	2	52085053	missense	probably damaging	1.00
R6342:Rif1	UTSW	2	52119156	missense	probably damaging	0.97
R6364:Rif1	UTSW	2	52107669	missense	probably damaging	0.97
R6747:Rif1	UTSW	2	52078263	splice site	probably null
R6928:Rif1	UTSW	2	52095961	missense	probably damaging	1.00
R6954:Rif1	UTSW	2	52112691	missense	probably benign	0.00
R7003:Rif1	UTSW	2	52076989	missense	probably benign	0.06
R7310:Rif1	UTSW	2	52105619	missense	probably benign	0.12
R7549:Rif1	UTSW	2	52078507	missense	possibly damaging	0.52
R7603:Rif1	UTSW	2	52076175	missense	probably damaging	1.00
R7673:Rif1	UTSW	2	52088654	missense	probably damaging	1.00
R7741:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R7777:Rif1	UTSW	2	52116356	missense	probably benign	0.00
R7910:Rif1	UTSW	2	52078387	nonsense	probably null
R7962:Rif1	UTSW	2	52074276	missense	probably damaging	1.00
R8264:Rif1	UTSW	2	52090278	missense	noncoding transcript
R8390:Rif1	UTSW	2	52110923	missense	probably damaging	1.00
R8479:Rif1	UTSW	2	52112551	missense	possibly damaging	0.52
R8490:Rif1	UTSW	2	52110999	missense	probably damaging	0.96
R8762:Rif1	UTSW	2	52111730	missense
R8785:Rif1	UTSW	2	52110481	missense	probably benign	0.06
R8890:Rif1	UTSW	2	52098863	missense	probably damaging	0.99
R9081:Rif1	UTSW	2	52110977	missense	probably damaging	0.99
R9225:Rif1	UTSW	2	52111850	missense	probably benign	0.22
R9284:Rif1	UTSW	2	52108552	missense	probably benign	0.00
R9300:Rif1	UTSW	2	52111139	missense	probably damaging	1.00
R9366:Rif1	UTSW	2	52120344	missense
R9477:Rif1	UTSW	2	52111330	missense	probably benign	0.02
R9522:Rif1	UTSW	2	52081299	missense	probably damaging	1.00
R9573:Rif1	UTSW	2	52110454	missense	probably benign	0.29
R9630:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
X0064:Rif1	UTSW	2	52074315	missense	probably benign	0.00
X0064:Rif1	UTSW	2	52094633	missense	probably damaging	0.96
Z1177:Rif1	UTSW	2	52088648	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTCTGTTGCTGAAACCAATCC -3'
(R):5'- TGTTCTGTTCGTGCTACAACTGAGG -3'

Sequencing Primer
(F):5'- CTAGTACAGAAACTTCGGTGGTC -3'
(R):5'- GCTACAACTGAGGCTGTACTTTC -3'

Posted On

2014-04-13