Mutagenetix > Incidental Mutations

Incidental Mutation 'R1517:Cnot1'

167101

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

039563-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1517 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 95743213 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1343 (T1343I)

Ref Sequence

ENSEMBL: ENSMUSP00000148735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000068452
AA Change: T1338I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: T1338I

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083155

Predicted Effect

probably benign
Transcript: ENSMUST00000098473
AA Change: T1343I

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: T1343I

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211887
AA Change: T1336I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

unknown
Transcript: ENSMUST00000211973
AA Change: T810I

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212340

Predicted Effect

probably benign
Transcript: ENSMUST00000212415

Predicted Effect

probably benign
Transcript: ENSMUST00000213006
AA Change: T1343I

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Meta Mutation Damage Score

0.0719

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.9%

Validation Efficiency

100% (67/67)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	C	11: 109,971,814	K375R	possibly damaging	Het
Adrb2	T	C	18: 62,178,800	N318S	probably damaging	Het
Akap5	A	C	12: 76,329,262	E489D	possibly damaging	Het
Aldh7a1	T	A	18: 56,532,061	I385F	probably damaging	Het
Astn1	T	A	1: 158,579,576		probably benign	Het
Atp7b	T	A	8: 21,997,358	T1314S	probably damaging	Het
Bhmt2	C	A	13: 93,662,339	G325C	probably damaging	Het
Brpf1	T	A	6: 113,319,089	V781E	probably benign	Het
Cacna1c	T	A	6: 118,598,759	Y1860F	probably benign	Het
Ccdc7a	T	C	8: 129,061,681	T56A	probably damaging	Het
Cep78	A	G	19: 15,959,663	S560P	probably damaging	Het
Coq10b	T	C	1: 55,064,257	S65P	probably damaging	Het
Creld1	T	A	6: 113,489,784	C243S	probably damaging	Het
Cst12	A	T	2: 148,793,252	I121F	possibly damaging	Het
Cyp26a1	A	C	19: 37,698,860	E165A	probably benign	Het
Cyp2d12	T	G	15: 82,558,136	M273R	probably damaging	Het
Dnajb7	T	A	15: 81,407,456	S227C	probably damaging	Het
Evc	T	A	5: 37,319,035	Q390L	probably damaging	Het
F830016B08Rik	T	A	18: 60,300,898	L351*	probably null	Het
Fga	T	C	3: 83,031,838	S507P	probably benign	Het
Gba	A	T	3: 89,206,148	Y239F	probably damaging	Het
Golga2	C	A	2: 32,305,984	Y843*	probably null	Het
Gria4	C	A	9: 4,793,865	L64F	probably damaging	Het
Hectd3	A	G	4: 117,002,994	Y803C	probably damaging	Het
Hmcn1	T	C	1: 150,669,421	K2812E	probably damaging	Het
Il17b	T	G	18: 61,690,245	V50G	probably damaging	Het
Itga2b	A	T	11: 102,466,325	L243*	probably null	Het
Kank4	C	A	4: 98,779,029	V394L	possibly damaging	Het
Kat14	T	A	2: 144,373,791	D65E	probably benign	Het
Kcnh3	T	C	15: 99,238,209	Y696H	probably damaging	Het
Kctd19	C	A	8: 105,395,376	D180Y	probably damaging	Het
Klra8	A	C	6: 130,115,640	S233A	probably benign	Het
Masp2	A	T	4: 148,612,106	T387S	possibly damaging	Het
Midn	C	A	10: 80,154,123	T275N	probably damaging	Het
Mis18bp1	A	G	12: 65,133,813	F965L	probably benign	Het
Myo3a	G	T	2: 22,282,634	V186L	probably damaging	Het
Ncoa2	T	A	1: 13,165,057	N884I	probably benign	Het
Olfr1082	T	A	2: 86,594,604	T75S	probably damaging	Het
Olfr272	A	T	4: 52,911,502	C97*	probably null	Het
Olfr963	T	C	9: 39,669,720	I221T	probably damaging	Het
Osr2	T	C	15: 35,300,667	V123A	probably benign	Het
P4ha2	A	G	11: 54,117,645	H226R	probably benign	Het
Pcdhb16	T	A	18: 37,478,098	V37E	probably benign	Het
Pcdhb18	T	A	18: 37,489,620	M1K	probably null	Het
Pcsk1	T	A	13: 75,098,047	Y181*	probably null	Het
Pros1	G	T	16: 62,885,512	C63F	probably damaging	Het
Ranbp3l	T	A	15: 9,065,001	C353*	probably null	Het
Rev3l	T	C	10: 39,838,443	Y2388H	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rpl12-ps1	G	T	1: 36,958,377		noncoding transcript	Het
Rttn	T	C	18: 89,113,350	V1951A	probably benign	Het
Scn9a	G	A	2: 66,505,027		probably benign	Het
Sdk1	T	C	5: 142,127,836	F1546S	probably damaging	Het
Sh3glb2	C	T	2: 30,354,975	R71Q	probably damaging	Het
Slc30a6	T	C	17: 74,408,847	F101L	probably benign	Het
Snrpd1	T	C	18: 10,626,913	I60T	probably damaging	Het
Sox10	T	A	15: 79,159,178	E218D	probably benign	Het
Tekt3	C	A	11: 63,070,490	H162N	probably damaging	Het
Tnfsf13	T	C	11: 69,684,738	S246G	possibly damaging	Het
Trim10	T	A	17: 36,872,454	I214N	probably damaging	Het
Trp63	C	A	16: 25,889,253	D566E	probably damaging	Het
Uck2	T	C	1: 167,234,724	D156G	probably damaging	Het
Zfp386	T	A	12: 116,059,605	S314R	possibly damaging	Het
Zfp467	C	T	6: 48,438,236	R494H	probably damaging	Het
Zfp735	A	T	11: 73,710,644	D138V	probably benign	Het
Zfyve26	T	C	12: 79,252,151	E445G	probably damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GTAAGTAACCAAGAGTTCACTGCCACA -3'
(R):5'- TGACATTAGCTGCCCCTACTCAAGA -3'

Sequencing Primer
(F):5'- tgattcccagaaccaatatggtag -3'
(R):5'- CCCTACTCAAGAGTTGAGACATAG -3'

Posted On

2014-04-13