Mutagenetix > Incidental Mutations

Incidental Mutation 'R1517:Gria4'

167104

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

039563-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.553) question?

Stock #

R1517 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 4793865 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 64 (L64F)

Ref Sequence

ENSEMBL: ENSMUSP00000129316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027020
AA Change: L64F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: L64F

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000063508
AA Change: L64F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: L64F

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163309
AA Change: L64F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892
AA Change: L64F

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3.2e-62	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212533
AA Change: L64F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

Meta Mutation Damage Score

0.5865

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.9%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	C	11: 109,971,814	K375R	possibly damaging	Het
Adrb2	T	C	18: 62,178,800	N318S	probably damaging	Het
Akap5	A	C	12: 76,329,262	E489D	possibly damaging	Het
Aldh7a1	T	A	18: 56,532,061	I385F	probably damaging	Het
Astn1	T	A	1: 158,579,576		probably benign	Het
Atp7b	T	A	8: 21,997,358	T1314S	probably damaging	Het
Bhmt2	C	A	13: 93,662,339	G325C	probably damaging	Het
Brpf1	T	A	6: 113,319,089	V781E	probably benign	Het
Cacna1c	T	A	6: 118,598,759	Y1860F	probably benign	Het
Ccdc7a	T	C	8: 129,061,681	T56A	probably damaging	Het
Cep78	A	G	19: 15,959,663	S560P	probably damaging	Het
Cnot1	G	A	8: 95,743,213	T1343I	probably benign	Het
Coq10b	T	C	1: 55,064,257	S65P	probably damaging	Het
Creld1	T	A	6: 113,489,784	C243S	probably damaging	Het
Cst12	A	T	2: 148,793,252	I121F	possibly damaging	Het
Cyp26a1	A	C	19: 37,698,860	E165A	probably benign	Het
Cyp2d12	T	G	15: 82,558,136	M273R	probably damaging	Het
Dnajb7	T	A	15: 81,407,456	S227C	probably damaging	Het
Evc	T	A	5: 37,319,035	Q390L	probably damaging	Het
F830016B08Rik	T	A	18: 60,300,898	L351*	probably null	Het
Fga	T	C	3: 83,031,838	S507P	probably benign	Het
Gba	A	T	3: 89,206,148	Y239F	probably damaging	Het
Golga2	C	A	2: 32,305,984	Y843*	probably null	Het
Hectd3	A	G	4: 117,002,994	Y803C	probably damaging	Het
Hmcn1	T	C	1: 150,669,421	K2812E	probably damaging	Het
Il17b	T	G	18: 61,690,245	V50G	probably damaging	Het
Itga2b	A	T	11: 102,466,325	L243*	probably null	Het
Kank4	C	A	4: 98,779,029	V394L	possibly damaging	Het
Kat14	T	A	2: 144,373,791	D65E	probably benign	Het
Kcnh3	T	C	15: 99,238,209	Y696H	probably damaging	Het
Kctd19	C	A	8: 105,395,376	D180Y	probably damaging	Het
Klra8	A	C	6: 130,115,640	S233A	probably benign	Het
Masp2	A	T	4: 148,612,106	T387S	possibly damaging	Het
Midn	C	A	10: 80,154,123	T275N	probably damaging	Het
Mis18bp1	A	G	12: 65,133,813	F965L	probably benign	Het
Myo3a	G	T	2: 22,282,634	V186L	probably damaging	Het
Ncoa2	T	A	1: 13,165,057	N884I	probably benign	Het
Olfr1082	T	A	2: 86,594,604	T75S	probably damaging	Het
Olfr272	A	T	4: 52,911,502	C97*	probably null	Het
Olfr963	T	C	9: 39,669,720	I221T	probably damaging	Het
Osr2	T	C	15: 35,300,667	V123A	probably benign	Het
P4ha2	A	G	11: 54,117,645	H226R	probably benign	Het
Pcdhb16	T	A	18: 37,478,098	V37E	probably benign	Het
Pcdhb18	T	A	18: 37,489,620	M1K	probably null	Het
Pcsk1	T	A	13: 75,098,047	Y181*	probably null	Het
Pros1	G	T	16: 62,885,512	C63F	probably damaging	Het
Ranbp3l	T	A	15: 9,065,001	C353*	probably null	Het
Rev3l	T	C	10: 39,838,443	Y2388H	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rpl12-ps1	G	T	1: 36,958,377		noncoding transcript	Het
Rttn	T	C	18: 89,113,350	V1951A	probably benign	Het
Scn9a	G	A	2: 66,505,027		probably benign	Het
Sdk1	T	C	5: 142,127,836	F1546S	probably damaging	Het
Sh3glb2	C	T	2: 30,354,975	R71Q	probably damaging	Het
Slc30a6	T	C	17: 74,408,847	F101L	probably benign	Het
Snrpd1	T	C	18: 10,626,913	I60T	probably damaging	Het
Sox10	T	A	15: 79,159,178	E218D	probably benign	Het
Tekt3	C	A	11: 63,070,490	H162N	probably damaging	Het
Tnfsf13	T	C	11: 69,684,738	S246G	possibly damaging	Het
Trim10	T	A	17: 36,872,454	I214N	probably damaging	Het
Trp63	C	A	16: 25,889,253	D566E	probably damaging	Het
Uck2	T	C	1: 167,234,724	D156G	probably damaging	Het
Zfp386	T	A	12: 116,059,605	S314R	possibly damaging	Het
Zfp467	C	T	6: 48,438,236	R494H	probably damaging	Het
Zfp735	A	T	11: 73,710,644	D138V	probably benign	Het
Zfyve26	T	C	12: 79,252,151	E445G	probably damaging	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7720:Gria4	UTSW	9	4464288	missense	probably damaging	1.00
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AAAGGAAGGCAGGCACTTACTTCAG -3'
(R):5'- GCAGCCCCTATGATATGGCAAAGAG -3'

Sequencing Primer
(F):5'- caaggaagggtggaaggaag -3'
(R):5'- ATGTTTGACAGTCATGGAACTAGG -3'

Posted On

2014-04-13