Incidental Mutation 'R1517:P4ha2'
ID 167111
Institutional Source Beutler Lab
Gene Symbol P4ha2
Ensembl Gene ENSMUSG00000018906
Gene Name procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide
Synonyms P4hl
MMRRC Submission 039563-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.366) question?
Stock # R1517 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 53991750-54022494 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54008471 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 226 (H226R)
Ref Sequence ENSEMBL: ENSMUSP00000133275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019050] [ENSMUST00000093107] [ENSMUST00000138477] [ENSMUST00000141258] [ENSMUST00000151218] [ENSMUST00000174616]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019050
AA Change: H226R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019050
Gene: ENSMUSG00000018906
AA Change: H226R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 28 159 2.6e-40 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
Blast:P4Hc 232 303 4e-13 BLAST
P4Hc 338 521 1.61e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093107
AA Change: H226R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091749
Gene: ENSMUSG00000018906
AA Change: H226R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 160 6.3e-44 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
P4Hc 338 519 7.67e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125651
Predicted Effect probably benign
Transcript: ENSMUST00000138477
SMART Domains Protein: ENSMUSP00000121119
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 158 3.1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141258
Predicted Effect probably benign
Transcript: ENSMUST00000151218
SMART Domains Protein: ENSMUSP00000118384
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 128 6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174616
AA Change: H226R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133275
Gene: ENSMUSG00000018906
AA Change: H226R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 160 6.3e-44 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
P4Hc 338 519 7.67e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155299
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,862,640 (GRCm39) K375R possibly damaging Het
Adrb2 T C 18: 62,311,871 (GRCm39) N318S probably damaging Het
Akap5 A C 12: 76,376,036 (GRCm39) E489D possibly damaging Het
Aldh7a1 T A 18: 56,665,133 (GRCm39) I385F probably damaging Het
Astn1 T A 1: 158,407,146 (GRCm39) probably benign Het
Atp7b T A 8: 22,487,374 (GRCm39) T1314S probably damaging Het
Bhmt2 C A 13: 93,798,847 (GRCm39) G325C probably damaging Het
Brpf1 T A 6: 113,296,050 (GRCm39) V781E probably benign Het
Cacna1c T A 6: 118,575,720 (GRCm39) Y1860F probably benign Het
Ccdc7a T C 8: 129,788,162 (GRCm39) T56A probably damaging Het
Cep78 A G 19: 15,937,027 (GRCm39) S560P probably damaging Het
Cnot1 G A 8: 96,469,841 (GRCm39) T1343I probably benign Het
Coq10b T C 1: 55,103,416 (GRCm39) S65P probably damaging Het
Creld1 T A 6: 113,466,745 (GRCm39) C243S probably damaging Het
Cst12 A T 2: 148,635,172 (GRCm39) I121F possibly damaging Het
Cyp26a1 A C 19: 37,687,308 (GRCm39) E165A probably benign Het
Cyp2d12 T G 15: 82,442,337 (GRCm39) M273R probably damaging Het
Dnajb7 T A 15: 81,291,657 (GRCm39) S227C probably damaging Het
Evc T A 5: 37,476,379 (GRCm39) Q390L probably damaging Het
F830016B08Rik T A 18: 60,433,970 (GRCm39) L351* probably null Het
Fga T C 3: 82,939,145 (GRCm39) S507P probably benign Het
Gba1 A T 3: 89,113,455 (GRCm39) Y239F probably damaging Het
Golga2 C A 2: 32,195,996 (GRCm39) Y843* probably null Het
Gria4 C A 9: 4,793,865 (GRCm39) L64F probably damaging Het
Hectd3 A G 4: 116,860,191 (GRCm39) Y803C probably damaging Het
Hmcn1 T C 1: 150,545,172 (GRCm39) K2812E probably damaging Het
Il17b T G 18: 61,823,316 (GRCm39) V50G probably damaging Het
Itga2b A T 11: 102,357,151 (GRCm39) L243* probably null Het
Kank4 C A 4: 98,667,266 (GRCm39) V394L possibly damaging Het
Kat14 T A 2: 144,215,711 (GRCm39) D65E probably benign Het
Kcnh3 T C 15: 99,136,090 (GRCm39) Y696H probably damaging Het
Kctd19 C A 8: 106,122,008 (GRCm39) D180Y probably damaging Het
Klra8 A C 6: 130,092,603 (GRCm39) S233A probably benign Het
Masp2 A T 4: 148,696,563 (GRCm39) T387S possibly damaging Het
Midn C A 10: 79,989,957 (GRCm39) T275N probably damaging Het
Mis18bp1 A G 12: 65,180,587 (GRCm39) F965L probably benign Het
Myo3a G T 2: 22,287,445 (GRCm39) V186L probably damaging Het
Ncoa2 T A 1: 13,235,281 (GRCm39) N884I probably benign Het
Or10d4 T C 9: 39,581,016 (GRCm39) I221T probably damaging Het
Or13c25 A T 4: 52,911,502 (GRCm39) C97* probably null Het
Or8k35 T A 2: 86,424,948 (GRCm39) T75S probably damaging Het
Osr2 T C 15: 35,300,813 (GRCm39) V123A probably benign Het
Pcdhb16 T A 18: 37,611,151 (GRCm39) V37E probably benign Het
Pcdhb18 T A 18: 37,622,673 (GRCm39) M1K probably null Het
Pcsk1 T A 13: 75,246,166 (GRCm39) Y181* probably null Het
Pros1 G T 16: 62,705,875 (GRCm39) C63F probably damaging Het
Ranbp3l T A 15: 9,065,081 (GRCm39) C353* probably null Het
Rev3l T C 10: 39,714,439 (GRCm39) Y2388H probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rpl12-ps1 G T 1: 36,997,458 (GRCm39) noncoding transcript Het
Rttn T C 18: 89,131,474 (GRCm39) V1951A probably benign Het
Scn9a G A 2: 66,335,371 (GRCm39) probably benign Het
Sdk1 T C 5: 142,113,591 (GRCm39) F1546S probably damaging Het
Sh3glb2 C T 2: 30,244,987 (GRCm39) R71Q probably damaging Het
Slc30a6 T C 17: 74,715,842 (GRCm39) F101L probably benign Het
Snrpd1 T C 18: 10,626,913 (GRCm39) I60T probably damaging Het
Sox10 T A 15: 79,043,378 (GRCm39) E218D probably benign Het
Tekt3 C A 11: 62,961,316 (GRCm39) H162N probably damaging Het
Tnfsf13 T C 11: 69,575,564 (GRCm39) S246G possibly damaging Het
Trim10 T A 17: 37,183,346 (GRCm39) I214N probably damaging Het
Trp63 C A 16: 25,708,003 (GRCm39) D566E probably damaging Het
Uck2 T C 1: 167,062,293 (GRCm39) D156G probably damaging Het
Zfp386 T A 12: 116,023,225 (GRCm39) S314R possibly damaging Het
Zfp467 C T 6: 48,415,170 (GRCm39) R494H probably damaging Het
Zfp735 A T 11: 73,601,470 (GRCm39) D138V probably benign Het
Zfyve26 T C 12: 79,298,925 (GRCm39) E445G probably damaging Het
Other mutations in P4ha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:P4ha2 APN 11 54,010,131 (GRCm39) missense probably damaging 1.00
IGL01324:P4ha2 APN 11 54,010,984 (GRCm39) missense probably damaging 0.99
IGL01953:P4ha2 APN 11 54,004,996 (GRCm39) missense probably benign 0.07
IGL02053:P4ha2 APN 11 54,008,413 (GRCm39) missense probably benign
FR4342:P4ha2 UTSW 11 54,001,077 (GRCm39) small deletion probably benign
R0471:P4ha2 UTSW 11 54,008,434 (GRCm39) missense possibly damaging 0.82
R0938:P4ha2 UTSW 11 54,010,148 (GRCm39) missense possibly damaging 0.67
R1467:P4ha2 UTSW 11 53,997,236 (GRCm39) intron probably benign
R1556:P4ha2 UTSW 11 54,015,836 (GRCm39) missense probably damaging 0.98
R3498:P4ha2 UTSW 11 54,010,079 (GRCm39) missense probably benign 0.28
R3916:P4ha2 UTSW 11 54,017,074 (GRCm39) missense probably benign 0.07
R4853:P4ha2 UTSW 11 54,010,996 (GRCm39) missense probably benign 0.01
R4932:P4ha2 UTSW 11 54,015,846 (GRCm39) missense probably benign 0.05
R5020:P4ha2 UTSW 11 54,022,016 (GRCm39) missense probably damaging 1.00
R5892:P4ha2 UTSW 11 54,011,014 (GRCm39) missense probably damaging 1.00
R5975:P4ha2 UTSW 11 54,017,238 (GRCm39) critical splice donor site probably null
R6632:P4ha2 UTSW 11 54,008,474 (GRCm39) missense probably benign 0.07
R7023:P4ha2 UTSW 11 54,022,072 (GRCm39) missense probably benign 0.01
R7068:P4ha2 UTSW 11 54,001,820 (GRCm39) missense probably benign 0.03
R8963:P4ha2 UTSW 11 54,004,995 (GRCm39) missense probably benign 0.01
R9215:P4ha2 UTSW 11 54,017,226 (GRCm39) missense probably benign 0.27
R9224:P4ha2 UTSW 11 54,009,963 (GRCm39) missense possibly damaging 0.92
R9336:P4ha2 UTSW 11 54,002,390 (GRCm39) missense possibly damaging 0.67
R9582:P4ha2 UTSW 11 54,022,065 (GRCm39) nonsense probably null
RF001:P4ha2 UTSW 11 54,001,061 (GRCm39) small deletion probably benign
RF018:P4ha2 UTSW 11 54,001,072 (GRCm39) frame shift probably null
RF035:P4ha2 UTSW 11 54,001,061 (GRCm39) small deletion probably benign
RF043:P4ha2 UTSW 11 54,001,076 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCGCTCAGCTTACAATGAAGGAGAC -3'
(R):5'- TGCATAGTGGTACAAGCACCACAAC -3'

Sequencing Primer
(F):5'- GGAGACTATTACCATACTGTGCTG -3'
(R):5'- AGTGTGTATAAGAAGCTACTCGGTG -3'
Posted On 2014-04-13