Mutagenetix > Incidental Mutation

Incidental Mutation 'R1517:Abca8b'

167117

Institutional Source

Beutler Lab

Gene Symbol

Abca8b

Ensembl Gene

ENSMUSG00000020620

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 8b

Synonyms

Abca8

MMRRC Submission

039563-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1517 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109932190-109995845 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109971814 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 375 (K375R)

Ref Sequence

ENSEMBL: ENSMUSP00000102280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]

AlphaFold

Q8K440

Predicted Effect

probably benign
Transcript: ENSMUST00000020948
AA Change: K437R

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: K437R

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	417	3.9e-28	PFAM
AAA	507	691	6.36e-10	SMART
Pfam:ABC2_membrane_3	859	1215	1e-10	PFAM
low complexity region	1246	1255	N/A	INTRINSIC
AAA	1313	1492	6.17e-8	SMART
low complexity region	1597	1607	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106669
AA Change: K375R

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: K375R

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	344	2.6e-16	PFAM
AAA	445	629	6.36e-10	SMART
transmembrane domain	798	815	N/A	INTRINSIC
transmembrane domain	1001	1023	N/A	INTRINSIC
transmembrane domain	1038	1060	N/A	INTRINSIC
transmembrane domain	1072	1091	N/A	INTRINSIC
transmembrane domain	1101	1123	N/A	INTRINSIC
transmembrane domain	1136	1158	N/A	INTRINSIC
low complexity region	1184	1193	N/A	INTRINSIC
AAA	1251	1430	6.17e-8	SMART
low complexity region	1535	1545	N/A	INTRINSIC

Meta Mutation Damage Score

0.1079

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.9%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adrb2	T	C	18: 62,178,800	N318S	probably damaging	Het
Akap5	A	C	12: 76,329,262	E489D	possibly damaging	Het
Aldh7a1	T	A	18: 56,532,061	I385F	probably damaging	Het
Astn1	T	A	1: 158,579,576		probably benign	Het
Atp7b	T	A	8: 21,997,358	T1314S	probably damaging	Het
Bhmt2	C	A	13: 93,662,339	G325C	probably damaging	Het
Brpf1	T	A	6: 113,319,089	V781E	probably benign	Het
Cacna1c	T	A	6: 118,598,759	Y1860F	probably benign	Het
Ccdc7a	T	C	8: 129,061,681	T56A	probably damaging	Het
Cep78	A	G	19: 15,959,663	S560P	probably damaging	Het
Cnot1	G	A	8: 95,743,213	T1343I	probably benign	Het
Coq10b	T	C	1: 55,064,257	S65P	probably damaging	Het
Creld1	T	A	6: 113,489,784	C243S	probably damaging	Het
Cst12	A	T	2: 148,793,252	I121F	possibly damaging	Het
Cyp26a1	A	C	19: 37,698,860	E165A	probably benign	Het
Cyp2d12	T	G	15: 82,558,136	M273R	probably damaging	Het
Dnajb7	T	A	15: 81,407,456	S227C	probably damaging	Het
Evc	T	A	5: 37,319,035	Q390L	probably damaging	Het
F830016B08Rik	T	A	18: 60,300,898	L351*	probably null	Het
Fga	T	C	3: 83,031,838	S507P	probably benign	Het
Gba	A	T	3: 89,206,148	Y239F	probably damaging	Het
Golga2	C	A	2: 32,305,984	Y843*	probably null	Het
Gria4	C	A	9: 4,793,865	L64F	probably damaging	Het
Hectd3	A	G	4: 117,002,994	Y803C	probably damaging	Het
Hmcn1	T	C	1: 150,669,421	K2812E	probably damaging	Het
Il17b	T	G	18: 61,690,245	V50G	probably damaging	Het
Itga2b	A	T	11: 102,466,325	L243*	probably null	Het
Kank4	C	A	4: 98,779,029	V394L	possibly damaging	Het
Kat14	T	A	2: 144,373,791	D65E	probably benign	Het
Kcnh3	T	C	15: 99,238,209	Y696H	probably damaging	Het
Kctd19	C	A	8: 105,395,376	D180Y	probably damaging	Het
Klra8	A	C	6: 130,115,640	S233A	probably benign	Het
Masp2	A	T	4: 148,612,106	T387S	possibly damaging	Het
Midn	C	A	10: 80,154,123	T275N	probably damaging	Het
Mis18bp1	A	G	12: 65,133,813	F965L	probably benign	Het
Myo3a	G	T	2: 22,282,634	V186L	probably damaging	Het
Ncoa2	T	A	1: 13,165,057	N884I	probably benign	Het
Olfr1082	T	A	2: 86,594,604	T75S	probably damaging	Het
Olfr272	A	T	4: 52,911,502	C97*	probably null	Het
Olfr963	T	C	9: 39,669,720	I221T	probably damaging	Het
Osr2	T	C	15: 35,300,667	V123A	probably benign	Het
P4ha2	A	G	11: 54,117,645	H226R	probably benign	Het
Pcdhb16	T	A	18: 37,478,098	V37E	probably benign	Het
Pcdhb18	T	A	18: 37,489,620	M1K	probably null	Het
Pcsk1	T	A	13: 75,098,047	Y181*	probably null	Het
Pros1	G	T	16: 62,885,512	C63F	probably damaging	Het
Ranbp3l	T	A	15: 9,065,001	C353*	probably null	Het
Rev3l	T	C	10: 39,838,443	Y2388H	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rpl12-ps1	G	T	1: 36,958,377		noncoding transcript	Het
Rttn	T	C	18: 89,113,350	V1951A	probably benign	Het
Scn9a	G	A	2: 66,505,027		probably benign	Het
Sdk1	T	C	5: 142,127,836	F1546S	probably damaging	Het
Sh3glb2	C	T	2: 30,354,975	R71Q	probably damaging	Het
Slc30a6	T	C	17: 74,408,847	F101L	probably benign	Het
Snrpd1	T	C	18: 10,626,913	I60T	probably damaging	Het
Sox10	T	A	15: 79,159,178	E218D	probably benign	Het
Tekt3	C	A	11: 63,070,490	H162N	probably damaging	Het
Tnfsf13	T	C	11: 69,684,738	S246G	possibly damaging	Het
Trim10	T	A	17: 36,872,454	I214N	probably damaging	Het
Trp63	C	A	16: 25,889,253	D566E	probably damaging	Het
Uck2	T	C	1: 167,234,724	D156G	probably damaging	Het
Zfp386	T	A	12: 116,059,605	S314R	possibly damaging	Het
Zfp467	C	T	6: 48,438,236	R494H	probably damaging	Het
Zfp735	A	T	11: 73,710,644	D138V	probably benign	Het
Zfyve26	T	C	12: 79,252,151	E445G	probably damaging	Het

Other mutations in Abca8b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Abca8b	APN	11	109953548	missense	possibly damaging	0.66
IGL00952:Abca8b	APN	11	109969060	critical splice donor site	probably null
IGL01141:Abca8b	APN	11	109937730	missense	probably damaging	1.00
IGL01523:Abca8b	APN	11	109976494	missense	probably damaging	1.00
IGL01633:Abca8b	APN	11	109936754	missense	probably damaging	0.99
IGL01862:Abca8b	APN	11	109947171	nonsense	probably null
IGL01963:Abca8b	APN	11	109971763	missense	probably damaging	0.99
IGL02169:Abca8b	APN	11	109952582	missense	probably damaging	0.98
IGL02536:Abca8b	APN	11	109981748	missense	probably benign	0.02
IGL02658:Abca8b	APN	11	109952560	missense	probably benign
IGL02828:Abca8b	APN	11	109980894	missense	probably damaging	0.99
IGL03118:Abca8b	APN	11	109947181	missense	possibly damaging	0.66
IGL03302:Abca8b	APN	11	109967750	missense	possibly damaging	0.80
IGL03325:Abca8b	APN	11	109953596	missense	possibly damaging	0.94
R0057:Abca8b	UTSW	11	109941559	missense	possibly damaging	0.91
R0131:Abca8b	UTSW	11	109942289	missense	possibly damaging	0.46
R0226:Abca8b	UTSW	11	109957018	splice site	probably null
R0426:Abca8b	UTSW	11	109955027	splice site	probably benign
R0432:Abca8b	UTSW	11	109980015	missense	possibly damaging	0.94
R0512:Abca8b	UTSW	11	109950650	missense	probably benign	0.32
R0589:Abca8b	UTSW	11	109942268	missense	probably damaging	0.96
R0690:Abca8b	UTSW	11	109969808	splice site	probably benign
R1263:Abca8b	UTSW	11	109941607	missense	possibly damaging	0.66
R1371:Abca8b	UTSW	11	109953553	missense	probably damaging	0.99
R1497:Abca8b	UTSW	11	109973821	splice site	probably benign
R1502:Abca8b	UTSW	11	109974645	missense	probably damaging	1.00
R1543:Abca8b	UTSW	11	109974674	missense	probably damaging	0.98
R1618:Abca8b	UTSW	11	109949888	splice site	probably benign
R1625:Abca8b	UTSW	11	109967121	missense	probably benign	0.11
R1753:Abca8b	UTSW	11	109973716	missense	probably benign	0.00
R1819:Abca8b	UTSW	11	109981056	critical splice acceptor site	probably null
R1822:Abca8b	UTSW	11	109957075	missense	possibly damaging	0.92
R1829:Abca8b	UTSW	11	109942341	missense	probably damaging	0.97
R1873:Abca8b	UTSW	11	109979955	missense	probably benign	0.01
R1899:Abca8b	UTSW	11	109937918	missense	possibly damaging	0.92
R1908:Abca8b	UTSW	11	109957098	missense	possibly damaging	0.92
R1962:Abca8b	UTSW	11	109979898	missense	probably benign	0.00
R1984:Abca8b	UTSW	11	109977841	missense	probably damaging	1.00
R2035:Abca8b	UTSW	11	109957106	missense	possibly damaging	0.94
R2092:Abca8b	UTSW	11	109966708	missense	possibly damaging	0.63
R2100:Abca8b	UTSW	11	109937782	missense	probably damaging	1.00
R2267:Abca8b	UTSW	11	109955148	missense	probably benign	0.03
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2873:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R3711:Abca8b	UTSW	11	109946255	missense	possibly damaging	0.46
R3937:Abca8b	UTSW	11	109974567	missense	probably benign	0.01
R4052:Abca8b	UTSW	11	109981725	nonsense	probably null
R4060:Abca8b	UTSW	11	109957201	missense	probably benign	0.04
R4207:Abca8b	UTSW	11	109981725	nonsense	probably null
R4208:Abca8b	UTSW	11	109981725	nonsense	probably null
R4354:Abca8b	UTSW	11	109971692	missense	probably benign	0.27
R4399:Abca8b	UTSW	11	109936385	missense	possibly damaging	0.66
R4456:Abca8b	UTSW	11	109942245	missense	probably benign	0.27
R4509:Abca8b	UTSW	11	109966755	missense	probably damaging	1.00
R4672:Abca8b	UTSW	11	109936448	missense	possibly damaging	0.81
R4868:Abca8b	UTSW	11	109974512	missense	probably benign	0.05
R5002:Abca8b	UTSW	11	109961797	missense	probably damaging	0.96
R5007:Abca8b	UTSW	11	109936764	missense	probably damaging	1.00
R5014:Abca8b	UTSW	11	109950131	missense	probably damaging	0.98
R5023:Abca8b	UTSW	11	109974988	critical splice donor site	probably null
R5091:Abca8b	UTSW	11	109936384	missense	possibly damaging	0.92
R5098:Abca8b	UTSW	11	109957118	missense	probably benign	0.05
R5117:Abca8b	UTSW	11	109966803	missense	probably damaging	1.00
R5234:Abca8b	UTSW	11	109976594	missense	possibly damaging	0.90
R5302:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5307:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5487:Abca8b	UTSW	11	109953514	missense	probably damaging	0.99
R5512:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5564:Abca8b	UTSW	11	109934581	missense	probably benign	0.08
R5610:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5677:Abca8b	UTSW	11	109940861	missense	probably damaging	1.00
R5723:Abca8b	UTSW	11	109953619	missense	possibly damaging	0.90
R5827:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5829:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5848:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5849:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5850:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5854:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5982:Abca8b	UTSW	11	109953597	missense	possibly damaging	0.80
R5994:Abca8b	UTSW	11	109949766	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6050:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R6145:Abca8b	UTSW	11	109973808	missense	probably benign	0.03
R6223:Abca8b	UTSW	11	109977846	missense	probably benign	0.00
R6349:Abca8b	UTSW	11	109934718	splice site	probably null
R7002:Abca8b	UTSW	11	109941564	missense	probably damaging	1.00
R7050:Abca8b	UTSW	11	109973718	missense	possibly damaging	0.90
R7107:Abca8b	UTSW	11	109976473	missense	probably damaging	0.98
R7158:Abca8b	UTSW	11	109934589	missense	probably damaging	1.00
R7170:Abca8b	UTSW	11	109945828	missense	probably benign	0.09
R7197:Abca8b	UTSW	11	109945822	nonsense	probably null
R7220:Abca8b	UTSW	11	109981717	missense	probably damaging	1.00
R7512:Abca8b	UTSW	11	109938449	missense	probably benign	0.01
R7590:Abca8b	UTSW	11	109938515	missense	probably damaging	0.97
R7658:Abca8b	UTSW	11	109935717	missense	probably benign	0.00
R7739:Abca8b	UTSW	11	109974591	missense	probably benign	0.05
R7797:Abca8b	UTSW	11	109971683	critical splice donor site	probably null
R7934:Abca8b	UTSW	11	109975039	missense	possibly damaging	0.75
R8074:Abca8b	UTSW	11	109938494	missense	probably benign
R8302:Abca8b	UTSW	11	109962580	critical splice donor site	probably null
R8341:Abca8b	UTSW	11	109955050	missense	probably damaging	1.00
R8486:Abca8b	UTSW	11	109967111	missense	possibly damaging	0.83
R8748:Abca8b	UTSW	11	109945771	missense	probably damaging	1.00
R8924:Abca8b	UTSW	11	109947177	missense	probably benign	0.00
R9002:Abca8b	UTSW	11	109952630	missense	probably benign	0.02
R9032:Abca8b	UTSW	11	109957247	missense	probably benign	0.04
R9099:Abca8b	UTSW	11	109980882	missense	probably damaging	1.00
R9124:Abca8b	UTSW	11	109937767	missense	probably damaging	0.97
R9178:Abca8b	UTSW	11	109950111	missense	probably benign	0.00
R9188:Abca8b	UTSW	11	109981735	nonsense	probably null
R9277:Abca8b	UTSW	11	109976521	missense	probably damaging	0.99
R9340:Abca8b	UTSW	11	109950113	missense	probably benign	0.43
R9371:Abca8b	UTSW	11	109967672	missense	probably damaging	1.00
R9382:Abca8b	UTSW	11	109979885	missense	probably benign
R9450:Abca8b	UTSW	11	109969104	missense	probably damaging	0.98
R9462:Abca8b	UTSW	11	109953607	missense
R9712:Abca8b	UTSW	11	109942337	missense	probably benign	0.30
Z1088:Abca8b	UTSW	11	109976482	missense	probably benign	0.09
Z1176:Abca8b	UTSW	11	109961908	missense	possibly damaging	0.52
Z1176:Abca8b	UTSW	11	109974644	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- ACGAGTGCTTTGCTTGCTTTCAATG -3'
(R):5'- TCCAGATGCCTAGCAGATCTTACCC -3'

Sequencing Primer
(F):5'- TGCTAAAATTTGAACTTCCTCTGTC -3'
(R):5'- CCTGGTAGGATTTTTCCTGATAAAGC -3'

Posted On

2014-04-13