Mutagenetix > Incidental Mutation

Incidental Mutation 'R1517:Pcsk1'

167123

Institutional Source

Beutler Lab

Gene Symbol

Pcsk1

Ensembl Gene

ENSMUSG00000021587

Gene Name

proprotein convertase subtilisin/kexin type 1

Synonyms

PC3, PC1, Nec-1, SPC3, prohormone convertase 1/3, Nec1, Phpp-1

MMRRC Submission

039563-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1517 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75089826-75134861 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 75098047 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 181 (Y181*)

Ref Sequence

ENSEMBL: ENSMUSP00000022075 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022075]

AlphaFold

P63239

PDB Structure

Solution Structure of the Mouse Prohormone Convertase 1 Pro-Domain [SOLUTION NMR]
PC1/3 DCSG sorting domain structure in DPC [SOLUTION NMR]
PC1/3 DCSG sorting domain in CHAPS [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000022075
AA Change: Y181*

SMART Domains

Protein: ENSMUSP00000022075
Gene: ENSMUSG00000021587
AA Change: Y181*

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:S8_pro-domain	34	110	6.4e-26	PFAM
Pfam:Peptidase_S8	158	442	2.2e-49	PFAM
Pfam:P_proprotein	504	591	6.1e-30	PFAM
low complexity region	679	694	N/A	INTRINSIC
Pfam:Proho_convert	713	751	4.3e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135349

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.9%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show pre- and postnatal death, low weight, diarrhea, hypoglycemia, low insulin and GHRH levels, and lack mature glucagon and ACTH levels. Homozygotes for another null allele die prior to implantation. ENU mutants show obesity, polyphagia and higher metabolic efficiency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	C	11: 109,971,814	K375R	possibly damaging	Het
Adrb2	T	C	18: 62,178,800	N318S	probably damaging	Het
Akap5	A	C	12: 76,329,262	E489D	possibly damaging	Het
Aldh7a1	T	A	18: 56,532,061	I385F	probably damaging	Het
Astn1	T	A	1: 158,579,576		probably benign	Het
Atp7b	T	A	8: 21,997,358	T1314S	probably damaging	Het
Bhmt2	C	A	13: 93,662,339	G325C	probably damaging	Het
Brpf1	T	A	6: 113,319,089	V781E	probably benign	Het
Cacna1c	T	A	6: 118,598,759	Y1860F	probably benign	Het
Ccdc7a	T	C	8: 129,061,681	T56A	probably damaging	Het
Cep78	A	G	19: 15,959,663	S560P	probably damaging	Het
Cnot1	G	A	8: 95,743,213	T1343I	probably benign	Het
Coq10b	T	C	1: 55,064,257	S65P	probably damaging	Het
Creld1	T	A	6: 113,489,784	C243S	probably damaging	Het
Cst12	A	T	2: 148,793,252	I121F	possibly damaging	Het
Cyp26a1	A	C	19: 37,698,860	E165A	probably benign	Het
Cyp2d12	T	G	15: 82,558,136	M273R	probably damaging	Het
Dnajb7	T	A	15: 81,407,456	S227C	probably damaging	Het
Evc	T	A	5: 37,319,035	Q390L	probably damaging	Het
F830016B08Rik	T	A	18: 60,300,898	L351*	probably null	Het
Fga	T	C	3: 83,031,838	S507P	probably benign	Het
Gba	A	T	3: 89,206,148	Y239F	probably damaging	Het
Golga2	C	A	2: 32,305,984	Y843*	probably null	Het
Gria4	C	A	9: 4,793,865	L64F	probably damaging	Het
Hectd3	A	G	4: 117,002,994	Y803C	probably damaging	Het
Hmcn1	T	C	1: 150,669,421	K2812E	probably damaging	Het
Il17b	T	G	18: 61,690,245	V50G	probably damaging	Het
Itga2b	A	T	11: 102,466,325	L243*	probably null	Het
Kank4	C	A	4: 98,779,029	V394L	possibly damaging	Het
Kat14	T	A	2: 144,373,791	D65E	probably benign	Het
Kcnh3	T	C	15: 99,238,209	Y696H	probably damaging	Het
Kctd19	C	A	8: 105,395,376	D180Y	probably damaging	Het
Klra8	A	C	6: 130,115,640	S233A	probably benign	Het
Masp2	A	T	4: 148,612,106	T387S	possibly damaging	Het
Midn	C	A	10: 80,154,123	T275N	probably damaging	Het
Mis18bp1	A	G	12: 65,133,813	F965L	probably benign	Het
Myo3a	G	T	2: 22,282,634	V186L	probably damaging	Het
Ncoa2	T	A	1: 13,165,057	N884I	probably benign	Het
Olfr1082	T	A	2: 86,594,604	T75S	probably damaging	Het
Olfr272	A	T	4: 52,911,502	C97*	probably null	Het
Olfr963	T	C	9: 39,669,720	I221T	probably damaging	Het
Osr2	T	C	15: 35,300,667	V123A	probably benign	Het
P4ha2	A	G	11: 54,117,645	H226R	probably benign	Het
Pcdhb16	T	A	18: 37,478,098	V37E	probably benign	Het
Pcdhb18	T	A	18: 37,489,620	M1K	probably null	Het
Pros1	G	T	16: 62,885,512	C63F	probably damaging	Het
Ranbp3l	T	A	15: 9,065,001	C353*	probably null	Het
Rev3l	T	C	10: 39,838,443	Y2388H	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rpl12-ps1	G	T	1: 36,958,377		noncoding transcript	Het
Rttn	T	C	18: 89,113,350	V1951A	probably benign	Het
Scn9a	G	A	2: 66,505,027		probably benign	Het
Sdk1	T	C	5: 142,127,836	F1546S	probably damaging	Het
Sh3glb2	C	T	2: 30,354,975	R71Q	probably damaging	Het
Slc30a6	T	C	17: 74,408,847	F101L	probably benign	Het
Snrpd1	T	C	18: 10,626,913	I60T	probably damaging	Het
Sox10	T	A	15: 79,159,178	E218D	probably benign	Het
Tekt3	C	A	11: 63,070,490	H162N	probably damaging	Het
Tnfsf13	T	C	11: 69,684,738	S246G	possibly damaging	Het
Trim10	T	A	17: 36,872,454	I214N	probably damaging	Het
Trp63	C	A	16: 25,889,253	D566E	probably damaging	Het
Uck2	T	C	1: 167,234,724	D156G	probably damaging	Het
Zfp386	T	A	12: 116,059,605	S314R	possibly damaging	Het
Zfp467	C	T	6: 48,438,236	R494H	probably damaging	Het
Zfp735	A	T	11: 73,710,644	D138V	probably benign	Het
Zfyve26	T	C	12: 79,252,151	E445G	probably damaging	Het

Other mutations in Pcsk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Pcsk1	APN	13	75132087	missense	probably benign
IGL01554:Pcsk1	APN	13	75132307	missense	probably benign
IGL01960:Pcsk1	APN	13	75093167	missense	possibly damaging	0.82
IGL02026:Pcsk1	APN	13	75112653	missense	probably benign	0.16
IGL02047:Pcsk1	APN	13	75097989	missense	probably benign	0.33
IGL02264:Pcsk1	APN	13	75105959	missense	probably damaging	1.00
IGL02441:Pcsk1	APN	13	75132163	missense	probably benign	0.16
IGL02795:Pcsk1	APN	13	75112620	missense	probably damaging	1.00
IGL02829:Pcsk1	APN	13	75126836	missense	probably damaging	1.00
IGL03116:Pcsk1	APN	13	75132216	missense	probably damaging	0.99
IGL03156:Pcsk1	APN	13	75131951	missense	probably benign
clipper	UTSW	13	75130070	missense	probably damaging	1.00
spareribs	UTSW	13	75115255	missense	possibly damaging	0.88
swivel	UTSW	13	75125984	missense	probably damaging	1.00
Tweeze	UTSW	13	75126839	missense	probably benign	0.00
PIT4453001:Pcsk1	UTSW	13	75112650	missense	probably damaging	1.00
R0771:Pcsk1	UTSW	13	75132162	missense	probably benign	0.31
R0894:Pcsk1	UTSW	13	75097977	missense	probably damaging	1.00
R1014:Pcsk1	UTSW	13	75132234	missense	probably damaging	1.00
R1035:Pcsk1	UTSW	13	75132119	missense	probably benign
R1199:Pcsk1	UTSW	13	75096413	splice site	probably benign
R1625:Pcsk1	UTSW	13	75126852	missense	probably benign	0.11
R1691:Pcsk1	UTSW	13	75132225	missense	possibly damaging	0.65
R1717:Pcsk1	UTSW	13	75110828	missense	probably damaging	0.99
R2168:Pcsk1	UTSW	13	75112534	intron	probably benign
R2252:Pcsk1	UTSW	13	75126726	missense	probably benign	0.00
R2400:Pcsk1	UTSW	13	75090126	missense	probably benign	0.00
R4110:Pcsk1	UTSW	13	75096369	missense	probably damaging	0.99
R4358:Pcsk1	UTSW	13	75112719	missense	possibly damaging	0.58
R4359:Pcsk1	UTSW	13	75112719	missense	possibly damaging	0.58
R4657:Pcsk1	UTSW	13	75132235	missense	probably damaging	1.00
R5195:Pcsk1	UTSW	13	75126855	missense	probably damaging	1.00
R5669:Pcsk1	UTSW	13	75130102	missense	probably benign	0.01
R5671:Pcsk1	UTSW	13	75097907	missense	possibly damaging	0.63
R5745:Pcsk1	UTSW	13	75131960	missense	probably benign	0.03
R6107:Pcsk1	UTSW	13	75127848	missense	probably benign	0.09
R6200:Pcsk1	UTSW	13	75115255	missense	possibly damaging	0.88
R6326:Pcsk1	UTSW	13	75132179	missense	possibly damaging	0.89
R6537:Pcsk1	UTSW	13	75132239	missense	probably damaging	1.00
R6541:Pcsk1	UTSW	13	75125984	missense	probably damaging	1.00
R6567:Pcsk1	UTSW	13	75130070	missense	probably damaging	1.00
R6723:Pcsk1	UTSW	13	75093069	splice site	probably null
R7258:Pcsk1	UTSW	13	75093186	missense	probably damaging	1.00
R7357:Pcsk1	UTSW	13	75125960	missense	probably damaging	0.96
R7487:Pcsk1	UTSW	13	75110883	missense	probably benign	0.01
R7519:Pcsk1	UTSW	13	75110865	missense	probably damaging	0.99
R7647:Pcsk1	UTSW	13	75132210	missense	possibly damaging	0.73
R7787:Pcsk1	UTSW	13	75132158	missense	possibly damaging	0.88
R7944:Pcsk1	UTSW	13	75132092	missense	probably benign
R7945:Pcsk1	UTSW	13	75132092	missense	probably benign
R7961:Pcsk1	UTSW	13	75126839	missense	probably benign	0.00
R8009:Pcsk1	UTSW	13	75126839	missense	probably benign	0.00
R8022:Pcsk1	UTSW	13	75099293	missense	possibly damaging	0.77
R8171:Pcsk1	UTSW	13	75090091	nonsense	probably null
R8489:Pcsk1	UTSW	13	75126002	missense	probably damaging	1.00
R9310:Pcsk1	UTSW	13	75090072	missense	probably benign
R9404:Pcsk1	UTSW	13	75132223	missense	probably benign	0.11
R9544:Pcsk1	UTSW	13	75110920	missense	probably damaging	0.99
R9588:Pcsk1	UTSW	13	75110920	missense	probably damaging	0.99
R9706:Pcsk1	UTSW	13	75099354	critical splice donor site	probably null
Z1176:Pcsk1	UTSW	13	75098042	missense	probably damaging	1.00
Z1177:Pcsk1	UTSW	13	75125864	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTATTTGGCTTGGACCCTCAACTTTG -3'
(R):5'- CAGTTCTAAATACAGTGTGGCTCCTGG -3'

Sequencing Primer
(F):5'- GGACCCTCAACTTTGTGCTTC -3'
(R):5'- ACTTCTGTTGCCTGTGCAATATTTG -3'

Posted On

2014-04-13