Mutagenetix > Incidental Mutation

Incidental Mutation 'R1517:Trp63'

167134

Institutional Source

Beutler Lab

Gene Symbol

Trp63

Ensembl Gene

ENSMUSG00000022510

Gene Name

transformation related protein 63

Synonyms

TAp63, deltaNp63, p63, p73L, p51/p63, KET protein, Trp53rp1

MMRRC Submission

039563-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.892) question?

Stock #

R1517 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25683763-25892102 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 25889253 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 566 (D566E)

Ref Sequence

ENSEMBL: ENSMUSP00000110961 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040231] [ENSMUST00000065523] [ENSMUST00000115306] [ENSMUST00000115310]

AlphaFold

O88898

Predicted Effect

probably damaging
Transcript: ENSMUST00000040231
AA Change: D570E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038117
Gene: ENSMUSG00000022510
AA Change: D570E

Domain	Start	End	E-Value	Type
Pfam:P53	69	265	5.4e-110	PFAM
Pfam:P53_tetramer	297	338	2.4e-20	PFAM
low complexity region	343	356	N/A	INTRINSIC
low complexity region	358	369	N/A	INTRINSIC
SAM	447	513	1.4e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000065523

SMART Domains

Protein: ENSMUSP00000067005
Gene: ENSMUSG00000022510

Domain	Start	End	E-Value	Type
Pfam:P53	163	359	4.9e-110	PFAM
Pfam:P53_tetramer	391	432	2.2e-20	PFAM
low complexity region	437	450	N/A	INTRINSIC
low complexity region	452	463	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115306
AA Change: D566E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110961
Gene: ENSMUSG00000022510
AA Change: D566E

Domain	Start	End	E-Value	Type
Pfam:P53	69	265	2.7e-110	PFAM
Pfam:P53_tetramer	293	334	9.2e-21	PFAM
low complexity region	339	352	N/A	INTRINSIC
low complexity region	354	365	N/A	INTRINSIC
SAM	443	509	1.4e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115310
AA Change: D664E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110965
Gene: ENSMUSG00000022510
AA Change: D664E

Domain	Start	End	E-Value	Type
Pfam:P53	163	359	1.3e-112	PFAM
Pfam:P53_tetramer	391	431	7e-21	PFAM
low complexity region	437	450	N/A	INTRINSIC
low complexity region	452	463	N/A	INTRINSIC
SAM	541	607	1.4e-7	SMART

Meta Mutation Damage Score

0.2641

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.9%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: This gene encodes tumor protein p63, a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include tumor proteins p53, p63, and p73, which have high sequence similarity to one another. This similarity allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways, including direct and indirect protein interactions. This results in mutual regulation of target gene promoters. Tumor protein p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Both alternative splicing and the use of alternative promoters result in multiple transcript variants encoding different protein isoforms.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygotes for null mutations lack hair follicles, teeth, eyelids, and all squamous epithelia and derivatives including mammary, lacrymal, salivary, and prostate glands. Mutants have craniofacial anomalies, missing or truncated limbs, and small genitalia, and they die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	C	11: 109,971,814	K375R	possibly damaging	Het
Adrb2	T	C	18: 62,178,800	N318S	probably damaging	Het
Akap5	A	C	12: 76,329,262	E489D	possibly damaging	Het
Aldh7a1	T	A	18: 56,532,061	I385F	probably damaging	Het
Astn1	T	A	1: 158,579,576		probably benign	Het
Atp7b	T	A	8: 21,997,358	T1314S	probably damaging	Het
Bhmt2	C	A	13: 93,662,339	G325C	probably damaging	Het
Brpf1	T	A	6: 113,319,089	V781E	probably benign	Het
Cacna1c	T	A	6: 118,598,759	Y1860F	probably benign	Het
Ccdc7a	T	C	8: 129,061,681	T56A	probably damaging	Het
Cep78	A	G	19: 15,959,663	S560P	probably damaging	Het
Cnot1	G	A	8: 95,743,213	T1343I	probably benign	Het
Coq10b	T	C	1: 55,064,257	S65P	probably damaging	Het
Creld1	T	A	6: 113,489,784	C243S	probably damaging	Het
Cst12	A	T	2: 148,793,252	I121F	possibly damaging	Het
Cyp26a1	A	C	19: 37,698,860	E165A	probably benign	Het
Cyp2d12	T	G	15: 82,558,136	M273R	probably damaging	Het
Dnajb7	T	A	15: 81,407,456	S227C	probably damaging	Het
Evc	T	A	5: 37,319,035	Q390L	probably damaging	Het
F830016B08Rik	T	A	18: 60,300,898	L351*	probably null	Het
Fga	T	C	3: 83,031,838	S507P	probably benign	Het
Gba	A	T	3: 89,206,148	Y239F	probably damaging	Het
Golga2	C	A	2: 32,305,984	Y843*	probably null	Het
Gria4	C	A	9: 4,793,865	L64F	probably damaging	Het
Hectd3	A	G	4: 117,002,994	Y803C	probably damaging	Het
Hmcn1	T	C	1: 150,669,421	K2812E	probably damaging	Het
Il17b	T	G	18: 61,690,245	V50G	probably damaging	Het
Itga2b	A	T	11: 102,466,325	L243*	probably null	Het
Kank4	C	A	4: 98,779,029	V394L	possibly damaging	Het
Kat14	T	A	2: 144,373,791	D65E	probably benign	Het
Kcnh3	T	C	15: 99,238,209	Y696H	probably damaging	Het
Kctd19	C	A	8: 105,395,376	D180Y	probably damaging	Het
Klra8	A	C	6: 130,115,640	S233A	probably benign	Het
Masp2	A	T	4: 148,612,106	T387S	possibly damaging	Het
Midn	C	A	10: 80,154,123	T275N	probably damaging	Het
Mis18bp1	A	G	12: 65,133,813	F965L	probably benign	Het
Myo3a	G	T	2: 22,282,634	V186L	probably damaging	Het
Ncoa2	T	A	1: 13,165,057	N884I	probably benign	Het
Olfr1082	T	A	2: 86,594,604	T75S	probably damaging	Het
Olfr272	A	T	4: 52,911,502	C97*	probably null	Het
Olfr963	T	C	9: 39,669,720	I221T	probably damaging	Het
Osr2	T	C	15: 35,300,667	V123A	probably benign	Het
P4ha2	A	G	11: 54,117,645	H226R	probably benign	Het
Pcdhb16	T	A	18: 37,478,098	V37E	probably benign	Het
Pcdhb18	T	A	18: 37,489,620	M1K	probably null	Het
Pcsk1	T	A	13: 75,098,047	Y181*	probably null	Het
Pros1	G	T	16: 62,885,512	C63F	probably damaging	Het
Ranbp3l	T	A	15: 9,065,001	C353*	probably null	Het
Rev3l	T	C	10: 39,838,443	Y2388H	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rpl12-ps1	G	T	1: 36,958,377		noncoding transcript	Het
Rttn	T	C	18: 89,113,350	V1951A	probably benign	Het
Scn9a	G	A	2: 66,505,027		probably benign	Het
Sdk1	T	C	5: 142,127,836	F1546S	probably damaging	Het
Sh3glb2	C	T	2: 30,354,975	R71Q	probably damaging	Het
Slc30a6	T	C	17: 74,408,847	F101L	probably benign	Het
Snrpd1	T	C	18: 10,626,913	I60T	probably damaging	Het
Sox10	T	A	15: 79,159,178	E218D	probably benign	Het
Tekt3	C	A	11: 63,070,490	H162N	probably damaging	Het
Tnfsf13	T	C	11: 69,684,738	S246G	possibly damaging	Het
Trim10	T	A	17: 36,872,454	I214N	probably damaging	Het
Uck2	T	C	1: 167,234,724	D156G	probably damaging	Het
Zfp386	T	A	12: 116,059,605	S314R	possibly damaging	Het
Zfp467	C	T	6: 48,438,236	R494H	probably damaging	Het
Zfp735	A	T	11: 73,710,644	D138V	probably benign	Het
Zfyve26	T	C	12: 79,252,151	E445G	probably damaging	Het

Other mutations in Trp63

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00935:Trp63	APN	16	25871076	missense	probably damaging	1.00
IGL01402:Trp63	APN	16	25820385	splice site	probably benign
IGL01404:Trp63	APN	16	25820385	splice site	probably benign
IGL01874:Trp63	APN	16	25882585	missense	possibly damaging	0.88
IGL01887:Trp63	APN	16	25865319	missense	probably damaging	1.00
IGL02008:Trp63	APN	16	25862461	missense	probably damaging	1.00
IGL02336:Trp63	APN	16	25820442	missense	probably damaging	1.00
IGL02470:Trp63	APN	16	25820384	splice site	probably benign
IGL02720:Trp63	APN	16	25863741	missense	probably damaging	0.96
IGL03230:Trp63	APN	16	25889010	missense	probably damaging	1.00
PIT4142001:Trp63	UTSW	16	25865263	missense	probably damaging	1.00
R0086:Trp63	UTSW	16	25871087	missense	probably damaging	1.00
R0281:Trp63	UTSW	16	25764302	splice site	probably benign
R1448:Trp63	UTSW	16	25889120	missense	possibly damaging	0.67
R1539:Trp63	UTSW	16	25884849	missense	probably benign	0.02
R3922:Trp63	UTSW	16	25889009	missense	probably damaging	1.00
R3977:Trp63	UTSW	16	25820740	intron	probably benign
R3978:Trp63	UTSW	16	25820740	intron	probably benign
R3979:Trp63	UTSW	16	25820740	intron	probably benign
R4689:Trp63	UTSW	16	25865262	missense	possibly damaging	0.90
R4870:Trp63	UTSW	16	25866218	makesense	probably null
R5009:Trp63	UTSW	16	25868227	missense	probably damaging	0.99
R5033:Trp63	UTSW	16	25763306	missense	probably damaging	0.99
R5058:Trp63	UTSW	16	25882594	missense	probably damaging	1.00
R5118:Trp63	UTSW	16	25889010	missense	unknown
R5354:Trp63	UTSW	16	25684355	splice site	probably null
R5363:Trp63	UTSW	16	25863718	missense	probably damaging	0.99
R5668:Trp63	UTSW	16	25866185	missense	possibly damaging	0.52
R6004:Trp63	UTSW	16	25763396	critical splice donor site	probably null
R6029:Trp63	UTSW	16	25868214	missense	probably damaging	1.00
R6170:Trp63	UTSW	16	25884853	missense	probably benign	0.28
R6186:Trp63	UTSW	16	25876733	intron	probably benign
R6266:Trp63	UTSW	16	25862460	missense	probably damaging	0.99
R6466:Trp63	UTSW	16	25763358	missense	probably damaging	1.00
R6486:Trp63	UTSW	16	25865340	missense	probably damaging	0.99
R6913:Trp63	UTSW	16	25889168	missense	probably damaging	1.00
R6980:Trp63	UTSW	16	25802093	missense	probably benign
R7097:Trp63	UTSW	16	25820477	missense	probably damaging	1.00
R7122:Trp63	UTSW	16	25820477	missense	probably damaging	1.00
R7544:Trp63	UTSW	16	25802087	missense	probably benign
R7690:Trp63	UTSW	16	25876733	missense	unknown
R7743:Trp63	UTSW	16	25882625	missense	probably benign	0.05
R7766:Trp63	UTSW	16	25868219	missense	probably damaging	0.97
R7792:Trp63	UTSW	16	25868224	missense	possibly damaging	0.94
R7816:Trp63	UTSW	16	25889240	missense	probably damaging	1.00
R7978:Trp63	UTSW	16	25820686	missense	unknown
R8324:Trp63	UTSW	16	25876734	missense	unknown
R8857:Trp63	UTSW	16	25820476	missense	probably damaging	1.00
R9041:Trp63	UTSW	16	25763333	missense	probably benign
R9123:Trp63	UTSW	16	25820497	missense	probably damaging	1.00
R9491:Trp63	UTSW	16	25876722	missense	unknown
R9642:Trp63	UTSW	16	25863758	missense	probably benign	0.35
Z1088:Trp63	UTSW	16	25763313	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CCTGAACAGTTCCGACATGCCATC -3'
(R):5'- AACAGGCAGCCTCCTAATTCTCCG -3'

Sequencing Primer
(F):5'- TTCCGACATGCCATCTGGAAG -3'
(R):5'- CGTCCCTTTAGAAACCAGACTG -3'

Posted On

2014-04-13