Mutagenetix > Incidental Mutations

Incidental Mutation 'R1518:Chst15'

167192

Institutional Source

Beutler Lab

Gene Symbol

Chst15

Ensembl Gene

ENSMUSG00000030930

Gene Name

carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15

Synonyms

MAd5, GalNAcS-6ST, MAd5, 4631426J05Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R1518 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

132235780-132317228 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 132270126 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 142 (N142S)

Ref Sequence

ENSEMBL: ENSMUSP00000079105 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077472] [ENSMUST00000080215] [ENSMUST00000124096]

AlphaFold

Q91XQ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000077472
AA Change: N142S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000076682
Gene: ENSMUSG00000030930
AA Change: N142S

Domain	Start	End	E-Value	Type
transmembrane domain	80	102	N/A	INTRINSIC
Pfam:Sulfotransfer_3	254	502	4.2e-10	PFAM
Pfam:Sulfotransfer_1	369	524	1.1e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000080215
AA Change: N142S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000079105
Gene: ENSMUSG00000030930
AA Change: N142S

Domain	Start	End	E-Value	Type
transmembrane domain	80	102	N/A	INTRINSIC
Pfam:Sulfotransfer_3	254	499	7.9e-9	PFAM
Pfam:Sulfotransfer_1	369	524	1.2e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132508

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chondroitin sulfate (CS) is a glycosaminoglycan which is an important structural component of the extracellular matrix and which links to proteins to form proteoglycans. Chondroitin sulfate E (CS-E) is an isomer of chondroitin sulfate in which the C-4 and C-6 hydroxyl groups are sulfated. This gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. This gene has also been identified as being co-expressed with RAG1 in B-cells and as potentially acting as a B-cell surface signaling receptor. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size and abnormal bone marrow-derived mast cell morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg4	T	A	9: 44,275,369	M493L	probably benign	Het
Abtb2	G	A	2: 103,709,284	V665I	probably benign	Het
Adamtsl1	C	G	4: 86,342,603	S1017W	probably damaging	Het
Aebp1	A	G	11: 5,871,469	T623A	possibly damaging	Het
Alox5	A	G	6: 116,413,780	F470S	probably damaging	Het
Angpt2	T	C	8: 18,705,839	E204G	probably benign	Het
Apip	A	G	2: 103,089,493	E138G	probably damaging	Het
Apob	C	T	12: 7,989,207	T466M	probably benign	Het
Atp2b3	GACAACA	GACA	X: 73,545,123		probably benign	Het
Atxn7l3	A	T	11: 102,294,514	D56E	probably benign	Het
Cacna1s	C	T	1: 136,098,551	A1092V	probably damaging	Het
Calr3	A	G	8: 72,427,200	F183L	probably damaging	Het
Cd300lb	T	A	11: 114,926,051	D55V	probably benign	Het
Chid1	A	C	7: 141,528,471	V145G	probably damaging	Het
Cnot4	C	T	6: 35,051,454	R409Q	probably damaging	Het
Cope	T	G	8: 70,312,761	I287S	possibly damaging	Het
Cpd	A	T	11: 76,840,386		probably null	Het
Cux1	G	T	5: 136,308,279	T785K	probably benign	Het
Dthd1	T	C	5: 62,822,040	S348P	probably damaging	Het
Eno3	G	T	11: 70,661,077	E64*	probably null	Het
Entpd1	T	A	19: 40,725,063	Y184*	probably null	Het
Erv3	A	T	2: 131,856,163	M92K	probably benign	Het
Flg2	T	A	3: 93,203,138	H824Q	unknown	Het
Fndc9	G	A	11: 46,238,103	G150S	probably benign	Het
Gdap1	G	A	1: 17,146,945	V43I	possibly damaging	Het
Ifi213	C	A	1: 173,589,663	L394F	probably damaging	Het
Ift88	A	G	14: 57,430,628	T29A	possibly damaging	Het
Kdm4c	A	T	4: 74,333,826	I437L	probably benign	Het
Kras	T	A	6: 145,232,251	E98D	probably benign	Het
Lcorl	C	A	5: 45,734,201	R353I	possibly damaging	Het
Lrrc4c	A	G	2: 97,630,576	I516V	probably benign	Het
Lrrc51	T	C	7: 101,915,596	D85G	probably damaging	Het
Lypd6b	G	A	2: 49,947,492	A159T	probably damaging	Het
Magel2	G	A	7: 62,380,440	V1031I	unknown	Het
Man1c1	A	T	4: 134,580,789	N338K	probably benign	Het
Mdn1	C	A	4: 32,739,977	Q3744K	probably damaging	Het
Micu3	G	T	8: 40,335,852	A135S	possibly damaging	Het
Muc4	T	C	16: 32,750,349	S76P	possibly damaging	Het
Nin	T	G	12: 70,014,773	T2106P	probably benign	Het
Nlrp4e	T	C	7: 23,321,843	I585T	probably benign	Het
Npy1r	C	T	8: 66,704,195	A89V	probably benign	Het
Olfr1136	A	T	2: 87,693,528	M118K	probably damaging	Het
Olfr1220	G	A	2: 89,097,600	A109V	probably benign	Het
Olfr608	T	A	7: 103,470,042	M1K	probably null	Het
Olfr665	T	A	7: 104,881,308	Y200*	probably null	Het
Olfr743	T	C	14: 50,534,165	V251A	probably damaging	Het
Parp14	T	G	16: 35,856,638	T987P	possibly damaging	Het
Pde7b	A	T	10: 20,548,121	V3E	probably damaging	Het
Pdlim7	G	T	13: 55,508,294	Y104*	probably null	Het
Pgm2l1	A	G	7: 100,261,725	K292R	probably benign	Het
Plec	T	C	15: 76,188,201	E728G	probably damaging	Het
Plppr4	T	C	3: 117,335,503	Y105C	probably damaging	Het
Polr1c	A	T	17: 46,247,895	N23K	possibly damaging	Het
Ppp5c	A	T	7: 17,009,936	M191K	probably damaging	Het
Prkca	T	C	11: 107,978,316	D57G	probably damaging	Het
Prkcb	A	G	7: 122,544,631		probably null	Het
Prl6a1	C	A	13: 27,318,927	Q169K	possibly damaging	Het
Prl6a1	A	T	13: 27,318,928	Q169L	probably null	Het
Psmd14	G	A	2: 61,760,991	R46H	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ramp2	A	G	11: 101,247,582	T22A	probably benign	Het
Rbm19	AGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGA	5: 120,140,280		probably benign	Het
Rbm25	A	T	12: 83,668,445	E463D	possibly damaging	Het
Retnlb	A	G	16: 48,817,315	I35V	probably benign	Het
Sestd1	A	G	2: 77,241,632	Y49H	probably damaging	Het
Setd2	T	A	9: 110,602,238	I2378N	probably damaging	Het
Slc26a1	A	T	5: 108,671,874	C486*	probably null	Het
Spef2	T	A	15: 9,667,230	I791F	probably damaging	Het
Sptb	T	C	12: 76,604,024	T1726A	possibly damaging	Het
St5	A	G	7: 109,557,355	S63P	probably damaging	Het
Stk38l	T	A	6: 146,771,631	M296K	probably benign	Het
Taf5	T	C	19: 47,081,846	F624L	probably damaging	Het
Tmem30c	G	T	16: 57,266,492	T316K	probably damaging	Het
Trpm2	A	G	10: 77,943,005	S376P	possibly damaging	Het
Vmn2r82	A	T	10: 79,378,868	L228F	probably damaging	Het
Zfp607b	G	A	7: 27,698,662	C57Y	possibly damaging	Het
Zfp983	A	G	17: 21,662,353	H399R	probably damaging	Het
Zfp984	A	T	4: 147,755,545	M283K	probably benign	Het

Other mutations in Chst15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01710:Chst15	APN	7	132270507	missense	probably benign	0.22
IGL01879:Chst15	APN	7	132270265	missense	possibly damaging	0.94
IGL02355:Chst15	APN	7	132266672	missense	probably benign	0.26
IGL02362:Chst15	APN	7	132266672	missense	probably benign	0.26
IGL02826:Chst15	APN	7	132266746	missense	probably damaging	1.00
IGL02860:Chst15	APN	7	132269102	missense	probably benign
IGL02972:Chst15	APN	7	132269173	missense	probably damaging	1.00
IGL03266:Chst15	APN	7	132270076	missense	probably damaging	1.00
IGL03331:Chst15	APN	7	132262713	missense	probably damaging	1.00
IGL03375:Chst15	APN	7	132270457	nonsense	probably null
R1476:Chst15	UTSW	7	132270273	missense	possibly damaging	0.95
R1501:Chst15	UTSW	7	132269069	nonsense	probably null
R1943:Chst15	UTSW	7	132262850	splice site	probably null
R2164:Chst15	UTSW	7	132270385	missense	probably damaging	0.97
R3947:Chst15	UTSW	7	132247875	missense	probably damaging	1.00
R4921:Chst15	UTSW	7	132247884	missense	probably benign	0.01
R5817:Chst15	UTSW	7	132269144	missense	probably damaging	0.99
R5817:Chst15	UTSW	7	132269147	missense	probably damaging	0.99
R5917:Chst15	UTSW	7	132270517	missense	probably benign
R6930:Chst15	UTSW	7	132269030	missense	possibly damaging	0.95
R7159:Chst15	UTSW	7	132270258	missense	probably damaging	1.00
R7911:Chst15	UTSW	7	132270522	missense	probably benign	0.12
R8282:Chst15	UTSW	7	132270150	missense	probably benign
R8342:Chst15	UTSW	7	132247886	missense	probably benign	0.15
R9011:Chst15	UTSW	7	132270517	missense	probably benign
R9093:Chst15	UTSW	7	132268917	critical splice donor site	probably null
R9329:Chst15	UTSW	7	132266791	missense	possibly damaging	0.46
R9352:Chst15	UTSW	7	132270528	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGGAAATGCCTGTCATGTTCCTC -3'
(R):5'- GCAGATGAACTTGCTTGCTGTTCTC -3'

Sequencing Primer
(F):5'- TCCTGTGTTCCCAAAGATGG -3'
(R):5'- AAGCGATGTAGCCTGGTC -3'

Posted On

2014-04-13