Incidental Mutation 'R1519:Spc25'
ID167245
Institutional Source Beutler Lab
Gene Symbol Spc25
Ensembl Gene ENSMUSG00000005233
Gene NameSPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)
Synonyms2600017H08Rik, Spbc25, 2610205L13Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R1519 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69193895-69206194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69200087 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 71 (I71V)
Ref Sequence ENSEMBL: ENSMUSP00000120999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005365] [ENSMUST00000112320] [ENSMUST00000127243] [ENSMUST00000149045] [ENSMUST00000149643] [ENSMUST00000167875]
Predicted Effect probably damaging
Transcript: ENSMUST00000005365
AA Change: I119V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005365
Gene: ENSMUSG00000005233
AA Change: I119V

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:Spindle_Spc25 148 222 6.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112320
AA Change: I119V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107939
Gene: ENSMUSG00000005233
AA Change: I119V

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:Spindle_Spc25 150 221 1.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126638
Predicted Effect possibly damaging
Transcript: ENSMUST00000127243
AA Change: I104V

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120142
Gene: ENSMUSG00000005233
AA Change: I104V

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
coiled coil region 57 113 N/A INTRINSIC
Pfam:Spindle_Spc25 133 207 4.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149045
AA Change: I71V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120999
Gene: ENSMUSG00000005233
AA Change: I71V

DomainStartEndE-ValueType
Pfam:Spindle_Spc25 100 133 3.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149401
Predicted Effect probably damaging
Transcript: ENSMUST00000149643
AA Change: I119V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117415
Gene: ENSMUSG00000005233
AA Change: I119V

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
PDB:3IZ0|E 99 167 3e-22 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000167875
AA Change: I71V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128039
Gene: ENSMUSG00000005233
AA Change: I71V

DomainStartEndE-ValueType
Pfam:Spindle_Spc25 100 174 1.7e-27 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the kinetochore-associated NDC80 protein complex, which is required for the mitotic spindle checkpoint and for microtubule-kinetochore attachment. During meiosis in mouse, the protein localizes to the germinal vesicle and then is associated with the chromosomes following germinal vesicle breakdown. Knockdown of this gene in oocytes results in precocious polar body extrusion, chromosome misalignment and aberrant spindle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
9230019H11Rik A G 10: 3,125,230 noncoding transcript Het
9530077C05Rik T G 9: 22,430,375 L114R probably benign Het
Abhd5 T C 9: 122,379,014 probably null Het
Acadvl A G 11: 70,014,791 probably null Het
Actn1 T C 12: 80,205,078 E75G probably damaging Het
Adam4 A T 12: 81,420,877 N323K possibly damaging Het
Anks6 G A 4: 47,027,152 R689W probably damaging Het
Anxa2 T C 9: 69,485,241 I124T probably damaging Het
Aph1c T C 9: 66,833,265 T10A probably benign Het
Arhgap40 T A 2: 158,546,801 W552R probably benign Het
Baz2b C T 2: 59,948,254 R754H possibly damaging Het
Blmh A G 11: 76,966,781 Y147C probably damaging Het
C1galt1 C T 6: 7,866,402 L83F probably damaging Het
Cd163l1 G A 7: 140,228,156 V747I probably benign Het
Cdh23 A T 10: 60,379,343 Y1403N possibly damaging Het
Cic A T 7: 25,293,810 probably null Het
Coro1b T A 19: 4,150,584 V200D possibly damaging Het
Csl T A 10: 99,757,955 E416V probably damaging Het
Cyp3a25 A G 5: 146,001,447 probably null Het
Dennd2d T A 3: 106,492,559 F266Y probably damaging Het
Dnah10 A G 5: 124,760,952 E1072G probably damaging Het
Dnah6 T A 6: 73,049,048 K3435N probably damaging Het
Dnah9 G A 11: 65,881,761 A3715V probably damaging Het
Fam186a G A 15: 99,947,655 S236L unknown Het
Fam198b A G 3: 79,941,464 N506D possibly damaging Het
Frs3 A G 17: 47,702,978 T199A probably benign Het
Fsd1 A G 17: 55,993,870 N243S probably benign Het
Gabra5 A C 7: 57,408,893 L369R probably benign Het
Gins4 A G 8: 23,234,776 V54A probably benign Het
Gli1 T C 10: 127,334,269 E339G possibly damaging Het
Gm12185 A G 11: 48,907,767 V633A probably damaging Het
Gm8251 A G 1: 44,056,970 V1656A probably benign Het
Gm8765 G A 13: 50,700,407 probably null Het
Gpr83 T A 9: 14,868,197 C182S probably null Het
Gspt1 A G 16: 11,220,855 V627A probably damaging Het
Heatr1 T C 13: 12,412,159 C722R probably benign Het
Jak1 C T 4: 101,162,922 R680Q probably damaging Het
Kif2c A G 4: 117,169,940 V287A probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Kmo A G 1: 175,656,802 E366G probably damaging Het
Lepr A T 4: 101,789,344 N824I probably damaging Het
Lyrm7 T A 11: 54,848,599 H75L possibly damaging Het
Map4k1 A T 7: 28,991,036 Q351L probably benign Het
Mgam T C 6: 40,661,683 I450T probably benign Het
Nbeal2 A G 9: 110,636,305 L955P probably damaging Het
Nlrp9c T C 7: 26,378,101 K752R possibly damaging Het
Nsmaf A T 4: 6,438,062 I70K probably benign Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr298 A G 7: 86,489,125 M142T probably damaging Het
Otud7a A G 7: 63,758,643 Y898C probably damaging Het
Pcdhb18 A C 18: 37,490,892 D425A probably damaging Het
Prdm1 A T 10: 44,439,986 L733* probably null Het
Prdm2 A T 4: 143,135,583 I379N probably damaging Het
Ptprg A T 14: 12,220,596 Y436F probably damaging Het
Riok3 A G 18: 12,137,306 D167G probably damaging Het
Rnf215 G T 11: 4,135,451 R60L probably damaging Het
Sdk1 A T 5: 141,999,950 H779L probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sh3d21 T A 4: 126,151,726 K387* probably null Het
Slc13a2 T C 11: 78,397,746 Y568C possibly damaging Het
Slc27a5 T C 7: 12,988,459 probably null Het
Slc32a1 T C 2: 158,614,577 L384P probably damaging Het
Sorcs1 T C 19: 50,252,587 N454D probably benign Het
Spag8 T C 4: 43,652,777 Y228C possibly damaging Het
Tcte1 T A 17: 45,535,252 F261I probably damaging Het
Thsd7a T A 6: 12,471,175 K481N probably benign Het
Tll2 G T 19: 41,086,400 N908K probably benign Het
Tmem236 T C 2: 14,192,280 V93A probably benign Het
Top2b G A 14: 16,408,953 probably null Het
Topaz1 G A 9: 122,767,011 S949N probably benign Het
Triobp A G 15: 78,973,738 T1180A probably benign Het
Trip11 A C 12: 101,886,160 D548E probably benign Het
Trpv2 T A 11: 62,589,826 probably null Het
Vmn1r12 T A 6: 57,159,555 H212Q probably damaging Het
Vmn2r112 A G 17: 22,618,903 T782A possibly damaging Het
Vmn2r7 A G 3: 64,716,455 V239A possibly damaging Het
Vmn2r80 T A 10: 79,194,219 N626K probably damaging Het
Vmn2r99 A G 17: 19,380,060 S449G probably benign Het
Wfikkn2 T C 11: 94,238,107 T403A probably benign Het
Xirp2 A G 2: 67,515,679 I2755V probably benign Het
Yjefn3 A G 8: 69,889,079 V153A probably benign Het
Zfp677 C A 17: 21,397,237 H185Q possibly damaging Het
Zfp947 C T 17: 22,146,292 V134I probably benign Het
Other mutations in Spc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Spc25 APN 2 69202608 nonsense probably null
IGL02273:Spc25 APN 2 69204929 splice site probably benign
IGL03163:Spc25 APN 2 69197204 missense probably damaging 1.00
R1604:Spc25 UTSW 2 69205154 missense probably damaging 0.99
R2913:Spc25 UTSW 2 69199987 missense probably benign 0.42
R3973:Spc25 UTSW 2 69202601 missense probably damaging 1.00
R4094:Spc25 UTSW 2 69202631 missense probably damaging 1.00
R4444:Spc25 UTSW 2 69204876 missense probably benign 0.06
R5293:Spc25 UTSW 2 69202652 missense possibly damaging 0.92
R6242:Spc25 UTSW 2 69197211 missense probably damaging 1.00
R6433:Spc25 UTSW 2 69206102 utr 5 prime probably benign
R6721:Spc25 UTSW 2 69197173 missense possibly damaging 0.96
R7712:Spc25 UTSW 2 69206137 missense unknown
R7866:Spc25 UTSW 2 69206062 critical splice donor site probably null
R8054:Spc25 UTSW 2 69204913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTCGATACAAATGCCAGTGAAAACC -3'
(R):5'- AGCAGTTGTAAACCAGCCTGAAATAAGG -3'

Sequencing Primer
(F):5'- GTCAAACTTTCATTAGACACTGGG -3'
(R):5'- GCAaacaacaataacaacaacaac -3'
Posted On2014-04-13