Incidental Mutation 'R1519:Nsmaf'
ID 167254
Institutional Source Beutler Lab
Gene Symbol Nsmaf
Ensembl Gene ENSMUSG00000028245
Gene Name neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms Fan, factor associated with N-SMase activation
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R1519 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 6396207-6454271 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 6438062 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 70 (I70K)
Ref Sequence ENSEMBL: ENSMUSP00000120980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029910] [ENSMUST00000124344]
AlphaFold O35242
Predicted Effect probably benign
Transcript: ENSMUST00000029910
AA Change: I70K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000029910
Gene: ENSMUSG00000028245
AA Change: I70K

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
GRAM 176 247 2.22e-11 SMART
Beach 302 575 6.28e-190 SMART
WD40 622 661 4.55e-3 SMART
WD40 664 703 2.97e0 SMART
WD40 706 743 1.47e-6 SMART
WD40 756 794 1.7e-2 SMART
WD40 797 836 1.02e-5 SMART
WD40 839 875 9.55e0 SMART
WD40 878 917 1.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124344
AA Change: I70K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120980
Gene: ENSMUSG00000028245
AA Change: I70K

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156715
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor. This protein is required for TNF-mediated activation of neutral sphingomyelinase and may play a role in regulating TNF-induced cellular responses such as inflammation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation show no gross phenotypic abnormalities but display delayed cutaneous barrier repair. In addition, D-galactosamine-sensitized homozygotes are partially resistant to LPS- and TNF-induced lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,439,390 (GRCm39) P187R probably damaging Het
Abhd5 T C 9: 122,208,079 (GRCm39) probably null Het
Acadvl A G 11: 69,905,617 (GRCm39) probably null Het
Actn1 T C 12: 80,251,852 (GRCm39) E75G probably damaging Het
Adam4 A T 12: 81,467,651 (GRCm39) N323K possibly damaging Het
Anks6 G A 4: 47,027,152 (GRCm39) R689W probably damaging Het
Anxa2 T C 9: 69,392,523 (GRCm39) I124T probably damaging Het
Aph1c T C 9: 66,740,547 (GRCm39) T10A probably benign Het
Arhgap40 T A 2: 158,388,721 (GRCm39) W552R probably benign Het
Baz2b C T 2: 59,778,598 (GRCm39) R754H possibly damaging Het
Blmh A G 11: 76,857,607 (GRCm39) Y147C probably damaging Het
C1galt1 C T 6: 7,866,402 (GRCm39) L83F probably damaging Het
Ccdc168 A G 1: 44,096,130 (GRCm39) V1656A probably benign Het
Cdh23 A T 10: 60,215,122 (GRCm39) Y1403N possibly damaging Het
Cic A T 7: 24,993,235 (GRCm39) probably null Het
Coro1b T A 19: 4,200,583 (GRCm39) V200D possibly damaging Het
Csl T A 10: 99,593,817 (GRCm39) E416V probably damaging Het
Cyp3a25 A G 5: 145,938,257 (GRCm39) probably null Het
Dennd2d T A 3: 106,399,875 (GRCm39) F266Y probably damaging Het
Dnah10 A G 5: 124,838,016 (GRCm39) E1072G probably damaging Het
Dnah6 T A 6: 73,026,031 (GRCm39) K3435N probably damaging Het
Dnah9 G A 11: 65,772,587 (GRCm39) A3715V probably damaging Het
Fam186a G A 15: 99,845,536 (GRCm39) S236L unknown Het
Frs3 A G 17: 48,013,903 (GRCm39) T199A probably benign Het
Fsd1 A G 17: 56,300,870 (GRCm39) N243S probably benign Het
Gabra5 A C 7: 57,058,641 (GRCm39) L369R probably benign Het
Gask1b A G 3: 79,848,771 (GRCm39) N506D possibly damaging Het
Gins4 A G 8: 23,724,792 (GRCm39) V54A probably benign Het
Gli1 T C 10: 127,170,138 (GRCm39) E339G possibly damaging Het
Gm12185 A G 11: 48,798,594 (GRCm39) V633A probably damaging Het
Gpr83 T A 9: 14,779,493 (GRCm39) C182S probably null Het
Gspt1 A G 16: 11,038,719 (GRCm39) V627A probably damaging Het
Heatr1 T C 13: 12,427,040 (GRCm39) C722R probably benign Het
Jak1 C T 4: 101,020,119 (GRCm39) R680Q probably damaging Het
Kif2c A G 4: 117,027,137 (GRCm39) V287A probably damaging Het
Kmo C T 1: 175,479,184 (GRCm39) P240L possibly damaging Het
Kmo A G 1: 175,484,368 (GRCm39) E366G probably damaging Het
Lepr A T 4: 101,646,541 (GRCm39) N824I probably damaging Het
Lyrm7 T A 11: 54,739,425 (GRCm39) H75L possibly damaging Het
Map4k1 A T 7: 28,690,461 (GRCm39) Q351L probably benign Het
Matcap2 T G 9: 22,341,671 (GRCm39) L114R probably benign Het
Mgam T C 6: 40,638,617 (GRCm39) I450T probably benign Het
Nbeal2 A G 9: 110,465,373 (GRCm39) L955P probably damaging Het
Nlrp9c T C 7: 26,077,526 (GRCm39) K752R possibly damaging Het
Or14a257 A G 7: 86,138,333 (GRCm39) M142T probably damaging Het
Or5ac19 C T 16: 59,089,307 (GRCm39) C241Y probably damaging Het
Otud7a A G 7: 63,408,391 (GRCm39) Y898C probably damaging Het
Pcdhb18 A C 18: 37,623,945 (GRCm39) D425A probably damaging Het
Prdm1 A T 10: 44,315,982 (GRCm39) L733* probably null Het
Prdm2 A T 4: 142,862,153 (GRCm39) I379N probably damaging Het
Ptprg A T 14: 12,220,596 (GRCm38) Y436F probably damaging Het
Riok3 A G 18: 12,270,363 (GRCm39) D167G probably damaging Het
Rnf215 G T 11: 4,085,451 (GRCm39) R60L probably damaging Het
Scart1 G A 7: 139,808,069 (GRCm39) V747I probably benign Het
Sdk1 A T 5: 141,985,705 (GRCm39) H779L probably benign Het
Serpine2 A G 1: 79,772,748 (GRCm39) F390L probably damaging Het
Sh3d21 T A 4: 126,045,519 (GRCm39) K387* probably null Het
Slc13a2 T C 11: 78,288,572 (GRCm39) Y568C possibly damaging Het
Slc27a5 T C 7: 12,722,386 (GRCm39) probably null Het
Slc32a1 T C 2: 158,456,497 (GRCm39) L384P probably damaging Het
Sorcs1 T C 19: 50,241,025 (GRCm39) N454D probably benign Het
Spag8 T C 4: 43,652,777 (GRCm39) Y228C possibly damaging Het
Spata31e4 G A 13: 50,854,443 (GRCm39) probably null Het
Spc25 T C 2: 69,030,431 (GRCm39) I71V probably damaging Het
Tcte1 T A 17: 45,846,178 (GRCm39) F261I probably damaging Het
Thsd7a T A 6: 12,471,174 (GRCm39) K481N probably benign Het
Tll2 G T 19: 41,074,839 (GRCm39) N908K probably benign Het
Tmem236 T C 2: 14,197,091 (GRCm39) V93A probably benign Het
Top2b G A 14: 16,408,953 (GRCm38) probably null Het
Topaz1 G A 9: 122,596,076 (GRCm39) S949N probably benign Het
Triobp A G 15: 78,857,938 (GRCm39) T1180A probably benign Het
Trip11 A C 12: 101,852,419 (GRCm39) D548E probably benign Het
Trpv2 T A 11: 62,480,652 (GRCm39) probably null Het
Ulbp3 A G 10: 3,075,230 (GRCm39) noncoding transcript Het
Vmn1r12 T A 6: 57,136,540 (GRCm39) H212Q probably damaging Het
Vmn2r112 A G 17: 22,837,884 (GRCm39) T782A possibly damaging Het
Vmn2r7 A G 3: 64,623,876 (GRCm39) V239A possibly damaging Het
Vmn2r80 T A 10: 79,030,053 (GRCm39) N626K probably damaging Het
Vmn2r99 A G 17: 19,600,322 (GRCm39) S449G probably benign Het
Wfikkn2 T C 11: 94,128,933 (GRCm39) T403A probably benign Het
Xirp2 A G 2: 67,346,023 (GRCm39) I2755V probably benign Het
Yjefn3 A G 8: 70,341,729 (GRCm39) V153A probably benign Het
Zfp677 C A 17: 21,617,499 (GRCm39) H185Q possibly damaging Het
Zfp947 C T 17: 22,365,273 (GRCm39) V134I probably benign Het
Other mutations in Nsmaf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Nsmaf APN 4 6,417,163 (GRCm39) critical splice donor site probably null
IGL00778:Nsmaf APN 4 6,435,056 (GRCm39) critical splice donor site probably null
IGL01775:Nsmaf APN 4 6,396,791 (GRCm39) missense possibly damaging 0.79
IGL02003:Nsmaf APN 4 6,418,522 (GRCm39) missense probably benign 0.02
IGL02039:Nsmaf APN 4 6,424,995 (GRCm39) splice site probably benign
IGL02085:Nsmaf APN 4 6,398,551 (GRCm39) missense probably benign 0.21
IGL02252:Nsmaf APN 4 6,398,378 (GRCm39) missense probably benign 0.00
IGL02655:Nsmaf APN 4 6,424,933 (GRCm39) missense possibly damaging 0.94
R0023:Nsmaf UTSW 4 6,408,680 (GRCm39) missense probably damaging 0.96
R0454:Nsmaf UTSW 4 6,424,874 (GRCm39) splice site probably null
R0538:Nsmaf UTSW 4 6,419,930 (GRCm39) splice site probably null
R0605:Nsmaf UTSW 4 6,418,470 (GRCm39) critical splice donor site probably null
R1033:Nsmaf UTSW 4 6,438,054 (GRCm39) missense probably damaging 1.00
R1472:Nsmaf UTSW 4 6,423,448 (GRCm39) nonsense probably null
R1641:Nsmaf UTSW 4 6,409,884 (GRCm39) missense probably benign 0.01
R1668:Nsmaf UTSW 4 6,398,880 (GRCm39) missense probably damaging 0.98
R2212:Nsmaf UTSW 4 6,396,732 (GRCm39) missense probably damaging 0.99
R2351:Nsmaf UTSW 4 6,437,921 (GRCm39) missense probably damaging 1.00
R3862:Nsmaf UTSW 4 6,435,064 (GRCm39) missense probably benign 0.00
R4112:Nsmaf UTSW 4 6,417,188 (GRCm39) nonsense probably null
R4644:Nsmaf UTSW 4 6,419,940 (GRCm39) splice site probably benign
R4807:Nsmaf UTSW 4 6,398,542 (GRCm39) splice site probably null
R4960:Nsmaf UTSW 4 6,423,342 (GRCm39) missense probably damaging 1.00
R5556:Nsmaf UTSW 4 6,398,621 (GRCm39) missense probably benign 0.00
R5936:Nsmaf UTSW 4 6,421,017 (GRCm39) intron probably benign
R7288:Nsmaf UTSW 4 6,416,641 (GRCm39) missense probably benign
R7295:Nsmaf UTSW 4 6,438,083 (GRCm39) missense probably benign 0.00
R7378:Nsmaf UTSW 4 6,416,586 (GRCm39) missense probably benign
R7615:Nsmaf UTSW 4 6,408,563 (GRCm39) missense probably damaging 1.00
R7842:Nsmaf UTSW 4 6,435,109 (GRCm39) critical splice acceptor site probably null
R7993:Nsmaf UTSW 4 6,398,647 (GRCm39) missense probably benign 0.15
R8737:Nsmaf UTSW 4 6,396,748 (GRCm39) missense probably benign 0.15
R8856:Nsmaf UTSW 4 6,433,320 (GRCm39) nonsense probably null
R8905:Nsmaf UTSW 4 6,424,951 (GRCm39) missense probably benign 0.07
R8963:Nsmaf UTSW 4 6,428,471 (GRCm39) missense probably damaging 0.98
R9019:Nsmaf UTSW 4 6,418,523 (GRCm39) missense probably damaging 1.00
R9097:Nsmaf UTSW 4 6,416,543 (GRCm39) frame shift probably null
R9099:Nsmaf UTSW 4 6,416,543 (GRCm39) frame shift probably null
R9288:Nsmaf UTSW 4 6,414,976 (GRCm39) missense probably benign 0.01
R9328:Nsmaf UTSW 4 6,426,412 (GRCm39) missense probably damaging 1.00
R9378:Nsmaf UTSW 4 6,440,940 (GRCm39) missense probably benign 0.00
R9481:Nsmaf UTSW 4 6,414,976 (GRCm39) missense probably benign 0.01
R9556:Nsmaf UTSW 4 6,408,637 (GRCm39) missense probably benign 0.08
R9745:Nsmaf UTSW 4 6,416,662 (GRCm39) missense possibly damaging 0.49
X0021:Nsmaf UTSW 4 6,398,543 (GRCm39) critical splice donor site probably null
X0063:Nsmaf UTSW 4 6,414,962 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTCCTGAGGACCAACTGCAATTC -3'
(R):5'- CACTGCTGAGCTTTGACTAGCTGAC -3'

Sequencing Primer
(F):5'- GAGTGAAATACCCCATGATTTTGCC -3'
(R):5'- AGCTTTGACTAGCTGACACCTTAG -3'
Posted On 2014-04-13