Mutagenetix > Incidental Mutation

Incidental Mutation 'R1519:Dnah10'

167265

Institutional Source

Beutler Lab

Gene Symbol

Dnah10

Ensembl Gene

ENSMUSG00000038011

Gene Name

dynein, axonemal, heavy chain 10

Synonyms

Dnahc10

Accession Numbers

Ncbi RefSeq: NM_019536.1; MGI:1860299

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1519 (G1)

Quality Score

218

Status

Not validated

Chromosome

Chromosomal Location

124725085-124834308 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 124760952 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1072 (E1072G)

Ref Sequence

ENSEMBL: ENSMUSP00000062995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058440] [ENSMUST00000141137]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000058440
AA Change: E1072G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011
AA Change: E1072G

Domain	Start	End	E-Value	Type
low complexity region	63	72	N/A	INTRINSIC
low complexity region	80	86	N/A	INTRINSIC
coiled coil region	260	282	N/A	INTRINSIC
Pfam:DHC_N1	305	878	9.1e-154	PFAM
coiled coil region	1191	1218	N/A	INTRINSIC
coiled coil region	1337	1360	N/A	INTRINSIC
Pfam:DHC_N2	1374	1782	1.7e-142	PFAM
AAA	1946	2082	2.51e-1	SMART
AAA	2225	2373	6.91e-1	SMART
low complexity region	2444	2464	N/A	INTRINSIC
AAA	2567	2720	2.29e-2	SMART
Pfam:AAA_8	2886	3153	9.8e-87	PFAM
Pfam:MT	3165	3502	9.1e-53	PFAM
Pfam:AAA_9	3522	3747	2.3e-90	PFAM
Pfam:Dynein_heavy	3884	4588	7.6e-240	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141137
AA Change: E1015G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011
AA Change: E1015G

Domain	Start	End	E-Value	Type
low complexity region	63	72	N/A	INTRINSIC
low complexity region	80	86	N/A	INTRINSIC
coiled coil region	260	282	N/A	INTRINSIC
Pfam:DHC_N1	304	607	4.3e-57	PFAM
Pfam:DHC_N1	598	823	1.2e-39	PFAM
coiled coil region	1134	1161	N/A	INTRINSIC
coiled coil region	1280	1303	N/A	INTRINSIC
Pfam:DHC_N2	1315	1727	7.3e-135	PFAM
AAA	1889	2025	4e-3	SMART
AAA	2168	2316	1.1e-2	SMART
low complexity region	2387	2407	N/A	INTRINSIC
AAA	2510	2663	3.6e-4	SMART
Pfam:AAA_8	2829	3096	2.5e-83	PFAM
Pfam:MT	3108	3445	1.2e-50	PFAM
Pfam:AAA_9	3461	3691	6.7e-59	PFAM
Pfam:Dynein_heavy	3821	4532	1.9e-231	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]).[supplied by OMIM, Mar 2008]

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	C	G	10: 100,603,528	P187R	probably damaging	Het
9230019H11Rik	A	G	10: 3,125,230		noncoding transcript	Het
9530077C05Rik	T	G	9: 22,430,375	L114R	probably benign	Het
Abhd5	T	C	9: 122,379,014		probably null	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Actn1	T	C	12: 80,205,078	E75G	probably damaging	Het
Adam4	A	T	12: 81,420,877	N323K	possibly damaging	Het
Anks6	G	A	4: 47,027,152	R689W	probably damaging	Het
Anxa2	T	C	9: 69,485,241	I124T	probably damaging	Het
Aph1c	T	C	9: 66,833,265	T10A	probably benign	Het
Arhgap40	T	A	2: 158,546,801	W552R	probably benign	Het
Baz2b	C	T	2: 59,948,254	R754H	possibly damaging	Het
Blmh	A	G	11: 76,966,781	Y147C	probably damaging	Het
C1galt1	C	T	6: 7,866,402	L83F	probably damaging	Het
Cd163l1	G	A	7: 140,228,156	V747I	probably benign	Het
Cdh23	A	T	10: 60,379,343	Y1403N	possibly damaging	Het
Cic	A	T	7: 25,293,810		probably null	Het
Coro1b	T	A	19: 4,150,584	V200D	possibly damaging	Het
Csl	T	A	10: 99,757,955	E416V	probably damaging	Het
Cyp3a25	A	G	5: 146,001,447		probably null	Het
Dennd2d	T	A	3: 106,492,559	F266Y	probably damaging	Het
Dnah6	T	A	6: 73,049,048	K3435N	probably damaging	Het
Dnah9	G	A	11: 65,881,761	A3715V	probably damaging	Het
Fam186a	G	A	15: 99,947,655	S236L	unknown	Het
Fam198b	A	G	3: 79,941,464	N506D	possibly damaging	Het
Frs3	A	G	17: 47,702,978	T199A	probably benign	Het
Fsd1	A	G	17: 55,993,870	N243S	probably benign	Het
Gabra5	A	C	7: 57,408,893	L369R	probably benign	Het
Gins4	A	G	8: 23,234,776	V54A	probably benign	Het
Gli1	T	C	10: 127,334,269	E339G	possibly damaging	Het
Gm12185	A	G	11: 48,907,767	V633A	probably damaging	Het
Gm8251	A	G	1: 44,056,970	V1656A	probably benign	Het
Gm8765	G	A	13: 50,700,407		probably null	Het
Gpr83	T	A	9: 14,868,197	C182S	probably null	Het
Gspt1	A	G	16: 11,220,855	V627A	probably damaging	Het
Heatr1	T	C	13: 12,412,159	C722R	probably benign	Het
Jak1	C	T	4: 101,162,922	R680Q	probably damaging	Het
Kif2c	A	G	4: 117,169,940	V287A	probably damaging	Het
Kmo	C	T	1: 175,651,618	P240L	possibly damaging	Het
Kmo	A	G	1: 175,656,802	E366G	probably damaging	Het
Lepr	A	T	4: 101,789,344	N824I	probably damaging	Het
Lyrm7	T	A	11: 54,848,599	H75L	possibly damaging	Het
Map4k1	A	T	7: 28,991,036	Q351L	probably benign	Het
Mgam	T	C	6: 40,661,683	I450T	probably benign	Het
Nbeal2	A	G	9: 110,636,305	L955P	probably damaging	Het
Nlrp9c	T	C	7: 26,378,101	K752R	possibly damaging	Het
Nsmaf	A	T	4: 6,438,062	I70K	probably benign	Het
Olfr201	C	T	16: 59,268,944	C241Y	probably damaging	Het
Olfr298	A	G	7: 86,489,125	M142T	probably damaging	Het
Otud7a	A	G	7: 63,758,643	Y898C	probably damaging	Het
Pcdhb18	A	C	18: 37,490,892	D425A	probably damaging	Het
Prdm1	A	T	10: 44,439,986	L733*	probably null	Het
Prdm2	A	T	4: 143,135,583	I379N	probably damaging	Het
Ptprg	A	T	14: 12,220,596	Y436F	probably damaging	Het
Riok3	A	G	18: 12,137,306	D167G	probably damaging	Het
Rnf215	G	T	11: 4,135,451	R60L	probably damaging	Het
Sdk1	A	T	5: 141,999,950	H779L	probably benign	Het
Serpine2	A	G	1: 79,795,031	F390L	probably damaging	Het
Sh3d21	T	A	4: 126,151,726	K387*	probably null	Het
Slc13a2	T	C	11: 78,397,746	Y568C	possibly damaging	Het
Slc27a5	T	C	7: 12,988,459		probably null	Het
Slc32a1	T	C	2: 158,614,577	L384P	probably damaging	Het
Sorcs1	T	C	19: 50,252,587	N454D	probably benign	Het
Spag8	T	C	4: 43,652,777	Y228C	possibly damaging	Het
Spc25	T	C	2: 69,200,087	I71V	probably damaging	Het
Tcte1	T	A	17: 45,535,252	F261I	probably damaging	Het
Thsd7a	T	A	6: 12,471,175	K481N	probably benign	Het
Tll2	G	T	19: 41,086,400	N908K	probably benign	Het
Tmem236	T	C	2: 14,192,280	V93A	probably benign	Het
Top2b	G	A	14: 16,408,953		probably null	Het
Topaz1	G	A	9: 122,767,011	S949N	probably benign	Het
Triobp	A	G	15: 78,973,738	T1180A	probably benign	Het
Trip11	A	C	12: 101,886,160	D548E	probably benign	Het
Trpv2	T	A	11: 62,589,826		probably null	Het
Vmn1r12	T	A	6: 57,159,555	H212Q	probably damaging	Het
Vmn2r112	A	G	17: 22,618,903	T782A	possibly damaging	Het
Vmn2r7	A	G	3: 64,716,455	V239A	possibly damaging	Het
Vmn2r80	T	A	10: 79,194,219	N626K	probably damaging	Het
Vmn2r99	A	G	17: 19,380,060	S449G	probably benign	Het
Wfikkn2	T	C	11: 94,238,107	T403A	probably benign	Het
Xirp2	A	G	2: 67,515,679	I2755V	probably benign	Het
Yjefn3	A	G	8: 69,889,079	V153A	probably benign	Het
Zfp677	C	A	17: 21,397,237	H185Q	possibly damaging	Het
Zfp947	C	T	17: 22,146,292	V134I	probably benign	Het

Other mutations in Dnah10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Dnah10	APN	5	124828603	missense	probably damaging	1.00
IGL00089:Dnah10	APN	5	124746616	missense	probably benign	0.01
IGL00471:Dnah10	APN	5	124794341	missense	probably damaging	1.00
IGL01336:Dnah10	APN	5	124775512	missense	probably damaging	1.00
IGL01339:Dnah10	APN	5	124777212	missense	probably damaging	1.00
IGL01372:Dnah10	APN	5	124779154	missense	probably damaging	1.00
IGL01572:Dnah10	APN	5	124783946	missense	probably damaging	1.00
IGL01634:Dnah10	APN	5	124821341	missense	probably damaging	0.98
IGL01649:Dnah10	APN	5	124732489	missense	probably damaging	0.97
IGL01676:Dnah10	APN	5	124803328	missense	possibly damaging	0.65
IGL01729:Dnah10	APN	5	124787465	missense	probably benign	0.10
IGL01757:Dnah10	APN	5	124768927	missense	probably benign	0.37
IGL01759:Dnah10	APN	5	124755786	missense	probably benign
IGL01767:Dnah10	APN	5	124743737	splice site	probably benign
IGL01769:Dnah10	APN	5	124764944	missense	possibly damaging	0.63
IGL01805:Dnah10	APN	5	124783921	missense	probably damaging	1.00
IGL02090:Dnah10	APN	5	124789812	missense	probably damaging	1.00
IGL02162:Dnah10	APN	5	124804746	missense	probably damaging	1.00
IGL02312:Dnah10	APN	5	124819366	missense	probably damaging	1.00
IGL02347:Dnah10	APN	5	124833423	critical splice acceptor site	probably null
IGL02378:Dnah10	APN	5	124773067	missense	probably damaging	1.00
IGL02440:Dnah10	APN	5	124773819	missense	probably damaging	1.00
IGL02457:Dnah10	APN	5	124789796	missense	probably damaging	1.00
IGL02487:Dnah10	APN	5	124793852	missense	possibly damaging	0.90
IGL02502:Dnah10	APN	5	124821287	missense	probably damaging	1.00
IGL02516:Dnah10	APN	5	124787331	missense	probably damaging	1.00
IGL02544:Dnah10	APN	5	124799005	missense	probably benign	0.26
IGL02709:Dnah10	APN	5	124773745	nonsense	probably null
IGL02740:Dnah10	APN	5	124826863	splice site	probably benign
IGL02746:Dnah10	APN	5	124730086	missense	possibly damaging	0.55
IGL02803:Dnah10	APN	5	124798014	missense	probably damaging	0.99
IGL02900:Dnah10	APN	5	124801822	missense	probably damaging	1.00
IGL02957:Dnah10	APN	5	124763133	missense	probably benign	0.07
IGL03076:Dnah10	APN	5	124730162	critical splice donor site	probably null
IGL03109:Dnah10	APN	5	124764886	missense	probably benign	0.10
IGL03181:Dnah10	APN	5	124748457	missense	probably damaging	0.99
IGL03185:Dnah10	APN	5	124817643	missense	probably damaging	1.00
IGL03199:Dnah10	APN	5	124817697	missense	probably benign	0.00
IGL03328:Dnah10	APN	5	124754290	missense	probably benign	0.06
frosty	UTSW	5	124828137	missense	probably damaging	1.00
H8562:Dnah10	UTSW	5	124829529	missense	probably damaging	1.00
I2288:Dnah10	UTSW	5	124730100	missense	probably benign
P0019:Dnah10	UTSW	5	124763066	missense	probably benign
P0037:Dnah10	UTSW	5	124817992	nonsense	probably null
PIT4366001:Dnah10	UTSW	5	124775524	missense	possibly damaging	0.95
R0004:Dnah10	UTSW	5	124726902	missense	probably benign
R0032:Dnah10	UTSW	5	124800891	missense	possibly damaging	0.94
R0032:Dnah10	UTSW	5	124800891	missense	possibly damaging	0.94
R0050:Dnah10	UTSW	5	124830744	missense	probably benign	0.00
R0066:Dnah10	UTSW	5	124763076	missense	probably benign	0.01
R0164:Dnah10	UTSW	5	124783834	missense	probably damaging	1.00
R0164:Dnah10	UTSW	5	124783834	missense	probably damaging	1.00
R0196:Dnah10	UTSW	5	124834075	missense	possibly damaging	0.80
R0312:Dnah10	UTSW	5	124796369	splice site	probably benign
R0321:Dnah10	UTSW	5	124823352	missense	probably benign	0.29
R0410:Dnah10	UTSW	5	124755735	missense	probably benign
R0480:Dnah10	UTSW	5	124808851	missense	probably damaging	1.00
R0531:Dnah10	UTSW	5	124812723	critical splice donor site	probably null
R0533:Dnah10	UTSW	5	124775250	splice site	probably null
R0599:Dnah10	UTSW	5	124800953	missense	probably damaging	1.00
R0686:Dnah10	UTSW	5	124747718	missense	possibly damaging	0.95
R0688:Dnah10	UTSW	5	124747718	missense	possibly damaging	0.95
R0780:Dnah10	UTSW	5	124750812	missense	possibly damaging	0.87
R0968:Dnah10	UTSW	5	124829577	missense	probably damaging	0.99
R0989:Dnah10	UTSW	5	124797938	missense	probably benign	0.00
R1203:Dnah10	UTSW	5	124760014	splice site	probably null
R1248:Dnah10	UTSW	5	124755823	splice site	probably benign
R1366:Dnah10	UTSW	5	124753326	missense	probably benign	0.41
R1434:Dnah10	UTSW	5	124774986	missense	probably benign	0.03
R1436:Dnah10	UTSW	5	124762221	missense	probably benign	0.00
R1438:Dnah10	UTSW	5	124798945	missense	probably benign	0.25
R1446:Dnah10	UTSW	5	124789796	missense	probably damaging	1.00
R1459:Dnah10	UTSW	5	124743686	missense	possibly damaging	0.90
R1466:Dnah10	UTSW	5	124763096	missense	probably benign
R1466:Dnah10	UTSW	5	124763096	missense	probably benign
R1479:Dnah10	UTSW	5	124777889	missense	possibly damaging	0.71
R1505:Dnah10	UTSW	5	124754239	missense	possibly damaging	0.82
R1565:Dnah10	UTSW	5	124829614	missense	probably damaging	1.00
R1668:Dnah10	UTSW	5	124765562	missense	probably benign	0.00
R1709:Dnah10	UTSW	5	124760091	missense	probably damaging	0.99
R1740:Dnah10	UTSW	5	124773190	splice site	probably null
R1828:Dnah10	UTSW	5	124761279	missense	probably benign	0.00
R1854:Dnah10	UTSW	5	124804689	missense	probably damaging	0.99
R1865:Dnah10	UTSW	5	124832526	splice site	probably null
R1893:Dnah10	UTSW	5	124754317	missense	probably benign	0.13
R1895:Dnah10	UTSW	5	124758430	missense	probably benign	0.00
R1906:Dnah10	UTSW	5	124800984	missense	probably damaging	1.00
R1953:Dnah10	UTSW	5	124782268	missense	probably benign	0.00
R1965:Dnah10	UTSW	5	124775203	missense	probably damaging	1.00
R2002:Dnah10	UTSW	5	124833988	missense	probably damaging	1.00
R2006:Dnah10	UTSW	5	124829587	missense	possibly damaging	0.58
R2037:Dnah10	UTSW	5	124746704	missense	probably benign	0.30
R2046:Dnah10	UTSW	5	124796341	missense	probably benign	0.25
R2074:Dnah10	UTSW	5	124814674	missense	probably damaging	1.00
R2081:Dnah10	UTSW	5	124774981	missense	possibly damaging	0.88
R2257:Dnah10	UTSW	5	124761237	missense	probably damaging	1.00
R2272:Dnah10	UTSW	5	124731466	missense	probably benign	0.00
R2293:Dnah10	UTSW	5	124819221	missense	probably damaging	0.97
R2323:Dnah10	UTSW	5	124742000	missense	probably damaging	1.00
R2435:Dnah10	UTSW	5	124762865	critical splice donor site	probably null
R2571:Dnah10	UTSW	5	124775478	missense	probably damaging	1.00
R2898:Dnah10	UTSW	5	124817670	missense	probably damaging	1.00
R2937:Dnah10	UTSW	5	124819412	critical splice donor site	probably null
R3439:Dnah10	UTSW	5	124796258	missense	possibly damaging	0.91
R3548:Dnah10	UTSW	5	124747630	missense	possibly damaging	0.50
R3881:Dnah10	UTSW	5	124773031	missense	probably benign	0.37
R4015:Dnah10	UTSW	5	124777926	missense	probably benign	0.25
R4261:Dnah10	UTSW	5	124730137	missense	possibly damaging	0.95
R4277:Dnah10	UTSW	5	124732330	missense	probably benign	0.28
R4299:Dnah10	UTSW	5	124819925	missense	probably damaging	1.00
R4613:Dnah10	UTSW	5	124762869	splice site	probably null
R4651:Dnah10	UTSW	5	124729143	missense	probably benign	0.20
R4652:Dnah10	UTSW	5	124729143	missense	probably benign	0.20
R4664:Dnah10	UTSW	5	124828472	missense	possibly damaging	0.95
R4665:Dnah10	UTSW	5	124828472	missense	possibly damaging	0.95
R4666:Dnah10	UTSW	5	124828472	missense	possibly damaging	0.95
R4691:Dnah10	UTSW	5	124775517	missense	probably damaging	1.00
R4755:Dnah10	UTSW	5	124747745	missense	probably benign	0.01
R4806:Dnah10	UTSW	5	124819344	missense	probably damaging	1.00
R4839:Dnah10	UTSW	5	124773132	missense	probably damaging	1.00
R4903:Dnah10	UTSW	5	124817748	missense	probably damaging	1.00
R5018:Dnah10	UTSW	5	124762196	missense	possibly damaging	0.79
R5101:Dnah10	UTSW	5	124832513	missense	possibly damaging	0.51
R5105:Dnah10	UTSW	5	124811482	missense	probably benign	0.01
R5119:Dnah10	UTSW	5	124779258	missense	probably damaging	1.00
R5139:Dnah10	UTSW	5	124798960	missense	probably damaging	0.99
R5242:Dnah10	UTSW	5	124787420	missense	probably benign	0.00
R5262:Dnah10	UTSW	5	124785156	missense	probably damaging	1.00
R5277:Dnah10	UTSW	5	124828137	missense	probably damaging	1.00
R5293:Dnah10	UTSW	5	124791787	missense	probably benign	0.01
R5322:Dnah10	UTSW	5	124773566	missense	probably damaging	1.00
R5371:Dnah10	UTSW	5	124743629	missense	probably benign	0.16
R5468:Dnah10	UTSW	5	124830493	missense	probably damaging	1.00
R5470:Dnah10	UTSW	5	124753168	missense	probably benign
R5587:Dnah10	UTSW	5	124793913	missense	probably benign	0.10
R5724:Dnah10	UTSW	5	124742026	missense	probably benign	0.27
R5797:Dnah10	UTSW	5	124821386	missense	probably benign	0.00
R5812:Dnah10	UTSW	5	124747746	missense	probably benign	0.01
R5846:Dnah10	UTSW	5	124823373	missense	possibly damaging	0.80
R5930:Dnah10	UTSW	5	124791791	critical splice donor site	probably null
R5961:Dnah10	UTSW	5	124811482	missense	probably benign	0.01
R5970:Dnah10	UTSW	5	124808729	missense	probably benign
R6021:Dnah10	UTSW	5	124736984	missense	probably damaging	1.00
R6043:Dnah10	UTSW	5	124801860	missense	probably damaging	1.00
R6073:Dnah10	UTSW	5	124819210	missense	probably benign	0.09
R6080:Dnah10	UTSW	5	124805897	missense	possibly damaging	0.71
R6093:Dnah10	UTSW	5	124753174	missense	probably benign	0.18
R6155:Dnah10	UTSW	5	124770599	missense	probably damaging	1.00
R6155:Dnah10	UTSW	5	124785175	missense	probably damaging	1.00
R6162:Dnah10	UTSW	5	124823318	missense	probably benign	0.02
R6238:Dnah10	UTSW	5	124743679	missense	probably damaging	0.97
R6248:Dnah10	UTSW	5	124794219	splice site	probably null
R6275:Dnah10	UTSW	5	124785184	missense	probably damaging	1.00
R6297:Dnah10	UTSW	5	124775080	missense	possibly damaging	0.55
R6388:Dnah10	UTSW	5	124829646	missense	probably benign	0.00
R6458:Dnah10	UTSW	5	124809269	missense	probably damaging	1.00
R6504:Dnah10	UTSW	5	124762782	missense	possibly damaging	0.50
R6518:Dnah10	UTSW	5	124758355	missense	probably damaging	0.99
R6627:Dnah10	UTSW	5	124830033	missense	probably damaging	1.00
R6701:Dnah10	UTSW	5	124760159	missense	probably benign	0.45
R6702:Dnah10	UTSW	5	124805805	missense	probably damaging	1.00
R6745:Dnah10	UTSW	5	124808812	missense	probably damaging	1.00
R6784:Dnah10	UTSW	5	124777826	missense	probably damaging	0.99
R6807:Dnah10	UTSW	5	124790000	splice site	probably null
R6932:Dnah10	UTSW	5	124821450	missense	possibly damaging	0.75
R7007:Dnah10	UTSW	5	124787426	missense	probably damaging	1.00
R7091:Dnah10	UTSW	5	124816142	missense	probably benign	0.37
R7138:Dnah10	UTSW	5	124822945	missense	probably damaging	1.00
R7144:Dnah10	UTSW	5	124822942	missense	probably damaging	0.98
R7231:Dnah10	UTSW	5	124813828	missense	probably benign	0.19
R7278:Dnah10	UTSW	5	124791791	critical splice donor site	probably null
R7284:Dnah10	UTSW	5	124832598	missense	probably benign	0.37
R7322:Dnah10	UTSW	5	124821269	missense	probably benign	0.08
R7523:Dnah10	UTSW	5	124747739	missense	probably damaging	0.97
R7565:Dnah10	UTSW	5	124799031	missense	probably damaging	1.00
R7593:Dnah10	UTSW	5	124746544	missense	probably benign	0.21
R7606:Dnah10	UTSW	5	124817712	missense	probably benign	0.00
R7835:Dnah10	UTSW	5	124777234	missense	probably damaging	1.00
R7898:Dnah10	UTSW	5	124782361	missense	probably damaging	1.00
R7972:Dnah10	UTSW	5	124726885	missense	probably benign
R7999:Dnah10	UTSW	5	124725258	missense	probably benign	0.06
R8017:Dnah10	UTSW	5	124800885	missense	probably benign	0.03
R8032:Dnah10	UTSW	5	124746612	missense	probably damaging	0.98
R8052:Dnah10	UTSW	5	124828511	missense	probably benign	0.00
R8088:Dnah10	UTSW	5	124754266	missense	probably benign	0.00
R8169:Dnah10	UTSW	5	124800882	missense	probably damaging	1.00
R8178:Dnah10	UTSW	5	124755726	missense	probably benign	0.11
R8200:Dnah10	UTSW	5	124828460	missense	probably damaging	1.00
R8210:Dnah10	UTSW	5	124750794	missense	probably benign	0.29
R8294:Dnah10	UTSW	5	124782346	missense	probably damaging	1.00
R8338:Dnah10	UTSW	5	124832502	missense	probably damaging	1.00
R8404:Dnah10	UTSW	5	124773542	missense	probably damaging	1.00
R8469:Dnah10	UTSW	5	124736831	missense	probably damaging	1.00
R8537:Dnah10	UTSW	5	124816100	missense	probably damaging	0.97
R8701:Dnah10	UTSW	5	124726847	missense	probably benign	0.00
R8723:Dnah10	UTSW	5	124814621	missense	probably damaging	0.99
R8770:Dnah10	UTSW	5	124775346	missense	possibly damaging	0.94
R8838:Dnah10	UTSW	5	124765550	missense	probably benign	0.09
R8879:Dnah10	UTSW	5	124818117	missense	probably damaging	1.00
R8928:Dnah10	UTSW	5	124789764	missense	probably damaging	0.98
R8932:Dnah10	UTSW	5	124800951	missense	possibly damaging	0.96
R8945:Dnah10	UTSW	5	124813942	missense	probably damaging	0.99
R8990:Dnah10	UTSW	5	124736993	missense
R9001:Dnah10	UTSW	5	124775451	missense	probably damaging	1.00
R9006:Dnah10	UTSW	5	124743719	missense	probably benign	0.23
R9060:Dnah10	UTSW	5	124828077	missense	probably damaging	1.00
R9085:Dnah10	UTSW	5	124762173	missense
R9133:Dnah10	UTSW	5	124782359	missense	probably damaging	1.00
R9155:Dnah10	UTSW	5	124830411	missense	probably damaging	0.99
R9220:Dnah10	UTSW	5	124794373	missense	probably benign	0.05
R9234:Dnah10	UTSW	5	124741925	missense	possibly damaging	0.94
R9264:Dnah10	UTSW	5	124736836	missense	probably damaging	1.00
R9266:Dnah10	UTSW	5	124768926	missense	probably benign	0.00
R9386:Dnah10	UTSW	5	124794443	critical splice donor site	probably null
R9446:Dnah10	UTSW	5	124746613	missense	probably damaging	1.00
R9484:Dnah10	UTSW	5	124823444	missense	probably damaging	1.00
R9594:Dnah10	UTSW	5	124830043	missense	probably damaging	1.00
R9691:Dnah10	UTSW	5	124775185	missense	probably damaging	0.98
RF015:Dnah10	UTSW	5	124818077	missense	probably damaging	1.00
RF021:Dnah10	UTSW	5	124777907	missense	probably damaging	1.00
T0975:Dnah10	UTSW	5	124763066	missense	probably benign
U24488:Dnah10	UTSW	5	124813980	missense	probably damaging	1.00
X0017:Dnah10	UTSW	5	124765697	missense	probably benign	0.22
Z1176:Dnah10	UTSW	5	124775355	missense	probably benign	0.11
Z1177:Dnah10	UTSW	5	124741955	missense	probably damaging	1.00
Z1177:Dnah10	UTSW	5	124747619	missense	possibly damaging	0.64
Z1177:Dnah10	UTSW	5	124817988	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCGCCTCCCTTTCCACACAG -3'
(R):5'- GCCGCAAACTTCTCCATCACGA -3'

Sequencing Primer
(F):5'- gagagagagagagagagagagg -3'
(R):5'- ATCACGATGGACTTGTCCAG -3'

Posted On

2014-04-13