Mutagenetix > Incidental Mutation

Incidental Mutation 'R1519:Sdk1'

167266

Institutional Source

Beutler Lab

Gene Symbol

Sdk1

Ensembl Gene

ENSMUSG00000039683

Gene Name

sidekick cell adhesion molecule 1

Synonyms

6720466O15Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R1519 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

141241490-142215586 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 141999950 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 779 (H779L)

Ref Sequence

ENSEMBL: ENSMUSP00000082928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]

AlphaFold

Q3UH53

Predicted Effect

probably benign
Transcript: ENSMUST00000074546
AA Change: H519L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: H519L

Domain	Start	End	E-Value	Type
IGc2	28	91	4.67e-4	SMART
IGc2	121	187	1.45e-9	SMART
IGc2	214	282	1.58e-10	SMART
IG	302	387	1.8e-5	SMART
FN3	390	474	7.39e-14	SMART
FN3	490	576	8.96e-13	SMART
FN3	591	679	1.95e-4	SMART
FN3	694	776	2e-10	SMART
FN3	792	879	4.22e-9	SMART
FN3	896	983	1.41e-10	SMART
FN3	999	1084	2.7e-7	SMART
FN3	1100	1183	1.3e-9	SMART
FN3	1199	1284	2.19e-7	SMART
FN3	1300	1408	5.73e-11	SMART
FN3	1424	1509	1.79e-12	SMART
FN3	1524	1611	1.16e-11	SMART
FN3	1625	1709	1.32e-10	SMART
transmembrane domain	1730	1752	N/A	INTRINSIC
low complexity region	1806	1815	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000085774
AA Change: H779L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: H779L

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	67	80	N/A	INTRINSIC
IGc2	99	158	2.77e-6	SMART
IG	179	264	3.74e-3	SMART
IGc2	288	351	4.67e-4	SMART
IGc2	381	447	1.45e-9	SMART
IGc2	474	542	1.58e-10	SMART
IG	562	647	1.8e-5	SMART
FN3	650	734	7.39e-14	SMART
FN3	750	836	8.96e-13	SMART
FN3	851	939	1.95e-4	SMART
FN3	954	1036	2e-10	SMART
FN3	1052	1139	4.22e-9	SMART
FN3	1156	1243	1.41e-10	SMART
FN3	1259	1344	2.7e-7	SMART
FN3	1360	1443	1.3e-9	SMART
FN3	1459	1544	2.19e-7	SMART
FN3	1560	1668	5.73e-11	SMART
FN3	1684	1769	1.79e-12	SMART
FN3	1784	1871	1.16e-11	SMART
FN3	1885	1969	1.32e-10	SMART
transmembrane domain	1990	2012	N/A	INTRINSIC
low complexity region	2066	2075	N/A	INTRINSIC
low complexity region	2106	2118	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	C	G	10: 100,603,528	P187R	probably damaging	Het
9230019H11Rik	A	G	10: 3,125,230		noncoding transcript	Het
9530077C05Rik	T	G	9: 22,430,375	L114R	probably benign	Het
Abhd5	T	C	9: 122,379,014		probably null	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Actn1	T	C	12: 80,205,078	E75G	probably damaging	Het
Adam4	A	T	12: 81,420,877	N323K	possibly damaging	Het
Anks6	G	A	4: 47,027,152	R689W	probably damaging	Het
Anxa2	T	C	9: 69,485,241	I124T	probably damaging	Het
Aph1c	T	C	9: 66,833,265	T10A	probably benign	Het
Arhgap40	T	A	2: 158,546,801	W552R	probably benign	Het
Baz2b	C	T	2: 59,948,254	R754H	possibly damaging	Het
Blmh	A	G	11: 76,966,781	Y147C	probably damaging	Het
C1galt1	C	T	6: 7,866,402	L83F	probably damaging	Het
Cd163l1	G	A	7: 140,228,156	V747I	probably benign	Het
Cdh23	A	T	10: 60,379,343	Y1403N	possibly damaging	Het
Cic	A	T	7: 25,293,810		probably null	Het
Coro1b	T	A	19: 4,150,584	V200D	possibly damaging	Het
Csl	T	A	10: 99,757,955	E416V	probably damaging	Het
Cyp3a25	A	G	5: 146,001,447		probably null	Het
Dennd2d	T	A	3: 106,492,559	F266Y	probably damaging	Het
Dnah10	A	G	5: 124,760,952	E1072G	probably damaging	Het
Dnah6	T	A	6: 73,049,048	K3435N	probably damaging	Het
Dnah9	G	A	11: 65,881,761	A3715V	probably damaging	Het
Fam186a	G	A	15: 99,947,655	S236L	unknown	Het
Fam198b	A	G	3: 79,941,464	N506D	possibly damaging	Het
Frs3	A	G	17: 47,702,978	T199A	probably benign	Het
Fsd1	A	G	17: 55,993,870	N243S	probably benign	Het
Gabra5	A	C	7: 57,408,893	L369R	probably benign	Het
Gins4	A	G	8: 23,234,776	V54A	probably benign	Het
Gli1	T	C	10: 127,334,269	E339G	possibly damaging	Het
Gm12185	A	G	11: 48,907,767	V633A	probably damaging	Het
Gm8251	A	G	1: 44,056,970	V1656A	probably benign	Het
Gm8765	G	A	13: 50,700,407		probably null	Het
Gpr83	T	A	9: 14,868,197	C182S	probably null	Het
Gspt1	A	G	16: 11,220,855	V627A	probably damaging	Het
Heatr1	T	C	13: 12,412,159	C722R	probably benign	Het
Jak1	C	T	4: 101,162,922	R680Q	probably damaging	Het
Kif2c	A	G	4: 117,169,940	V287A	probably damaging	Het
Kmo	C	T	1: 175,651,618	P240L	possibly damaging	Het
Kmo	A	G	1: 175,656,802	E366G	probably damaging	Het
Lepr	A	T	4: 101,789,344	N824I	probably damaging	Het
Lyrm7	T	A	11: 54,848,599	H75L	possibly damaging	Het
Map4k1	A	T	7: 28,991,036	Q351L	probably benign	Het
Mgam	T	C	6: 40,661,683	I450T	probably benign	Het
Nbeal2	A	G	9: 110,636,305	L955P	probably damaging	Het
Nlrp9c	T	C	7: 26,378,101	K752R	possibly damaging	Het
Nsmaf	A	T	4: 6,438,062	I70K	probably benign	Het
Olfr201	C	T	16: 59,268,944	C241Y	probably damaging	Het
Olfr298	A	G	7: 86,489,125	M142T	probably damaging	Het
Otud7a	A	G	7: 63,758,643	Y898C	probably damaging	Het
Pcdhb18	A	C	18: 37,490,892	D425A	probably damaging	Het
Prdm1	A	T	10: 44,439,986	L733*	probably null	Het
Prdm2	A	T	4: 143,135,583	I379N	probably damaging	Het
Ptprg	A	T	14: 12,220,596	Y436F	probably damaging	Het
Riok3	A	G	18: 12,137,306	D167G	probably damaging	Het
Rnf215	G	T	11: 4,135,451	R60L	probably damaging	Het
Serpine2	A	G	1: 79,795,031	F390L	probably damaging	Het
Sh3d21	T	A	4: 126,151,726	K387*	probably null	Het
Slc13a2	T	C	11: 78,397,746	Y568C	possibly damaging	Het
Slc27a5	T	C	7: 12,988,459		probably null	Het
Slc32a1	T	C	2: 158,614,577	L384P	probably damaging	Het
Sorcs1	T	C	19: 50,252,587	N454D	probably benign	Het
Spag8	T	C	4: 43,652,777	Y228C	possibly damaging	Het
Spc25	T	C	2: 69,200,087	I71V	probably damaging	Het
Tcte1	T	A	17: 45,535,252	F261I	probably damaging	Het
Thsd7a	T	A	6: 12,471,175	K481N	probably benign	Het
Tll2	G	T	19: 41,086,400	N908K	probably benign	Het
Tmem236	T	C	2: 14,192,280	V93A	probably benign	Het
Top2b	G	A	14: 16,408,953		probably null	Het
Topaz1	G	A	9: 122,767,011	S949N	probably benign	Het
Triobp	A	G	15: 78,973,738	T1180A	probably benign	Het
Trip11	A	C	12: 101,886,160	D548E	probably benign	Het
Trpv2	T	A	11: 62,589,826		probably null	Het
Vmn1r12	T	A	6: 57,159,555	H212Q	probably damaging	Het
Vmn2r112	A	G	17: 22,618,903	T782A	possibly damaging	Het
Vmn2r7	A	G	3: 64,716,455	V239A	possibly damaging	Het
Vmn2r80	T	A	10: 79,194,219	N626K	probably damaging	Het
Vmn2r99	A	G	17: 19,380,060	S449G	probably benign	Het
Wfikkn2	T	C	11: 94,238,107	T403A	probably benign	Het
Xirp2	A	G	2: 67,515,679	I2755V	probably benign	Het
Yjefn3	A	G	8: 69,889,079	V153A	probably benign	Het
Zfp677	C	A	17: 21,397,237	H185Q	possibly damaging	Het
Zfp947	C	T	17: 22,146,292	V134I	probably benign	Het

Other mutations in Sdk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Sdk1	APN	5	142085606	missense	probably damaging	1.00
IGL00945:Sdk1	APN	5	142084613	critical splice donor site	probably null
IGL00946:Sdk1	APN	5	142084613	critical splice donor site	probably null
IGL01394:Sdk1	APN	5	141613215	missense	probably benign	0.03
IGL01398:Sdk1	APN	5	141937577	missense	probably benign	0.00
IGL01410:Sdk1	APN	5	142212120	missense	probably benign	0.30
IGL01525:Sdk1	APN	5	141999920	missense	probably damaging	1.00
IGL01548:Sdk1	APN	5	142085765	missense	possibly damaging	0.95
IGL01672:Sdk1	APN	5	142185175	missense	probably benign	0.33
IGL01676:Sdk1	APN	5	142127836	missense	probably damaging	0.99
IGL01679:Sdk1	APN	5	142046164	missense	probably benign
IGL01929:Sdk1	APN	5	141953030	missense	probably damaging	0.99
IGL01970:Sdk1	APN	5	142085682	missense	possibly damaging	0.67
IGL02016:Sdk1	APN	5	142034429	missense	possibly damaging	0.85
IGL02060:Sdk1	APN	5	141953012	missense	possibly damaging	0.79
IGL02457:Sdk1	APN	5	141953016	missense	probably damaging	1.00
IGL02634:Sdk1	APN	5	141610032	missense	probably benign	0.01
IGL02637:Sdk1	APN	5	142094572	missense	probably damaging	1.00
IGL02731:Sdk1	APN	5	142172544	missense	probably damaging	1.00
IGL03180:Sdk1	APN	5	142085742	missense	probably damaging	0.96
IGL03259:Sdk1	APN	5	141953033	nonsense	probably null
PIT4453001:Sdk1	UTSW	5	142212038	missense	probably benign	0.00
PIT4544001:Sdk1	UTSW	5	141956232	missense	probably benign	0.08
R0149:Sdk1	UTSW	5	141857054	intron	probably benign
R0173:Sdk1	UTSW	5	142173809	splice site	probably benign
R0240:Sdk1	UTSW	5	141998747	missense	probably damaging	1.00
R0240:Sdk1	UTSW	5	141998747	missense	probably damaging	1.00
R0242:Sdk1	UTSW	5	142143922	splice site	probably benign
R0245:Sdk1	UTSW	5	141954958	missense	probably benign	0.02
R0270:Sdk1	UTSW	5	142084566	missense	possibly damaging	0.79
R0398:Sdk1	UTSW	5	141962721	missense	probably benign	0.05
R0401:Sdk1	UTSW	5	142046161	missense	possibly damaging	0.55
R0501:Sdk1	UTSW	5	141937718	missense	probably benign
R0558:Sdk1	UTSW	5	142132065	missense	probably damaging	1.00
R0652:Sdk1	UTSW	5	141954958	missense	probably benign	0.02
R0834:Sdk1	UTSW	5	141242024	missense	probably benign
R0962:Sdk1	UTSW	5	142161875	missense	probably damaging	1.00
R1424:Sdk1	UTSW	5	142161866	missense	probably damaging	1.00
R1438:Sdk1	UTSW	5	142038323	missense	probably damaging	0.96
R1517:Sdk1	UTSW	5	142127836	missense	probably damaging	0.99
R1539:Sdk1	UTSW	5	142094599	missense	probably damaging	1.00
R1574:Sdk1	UTSW	5	141998879	missense	probably benign	0.03
R1574:Sdk1	UTSW	5	141998879	missense	probably benign	0.03
R1673:Sdk1	UTSW	5	141948506	missense	possibly damaging	0.90
R1686:Sdk1	UTSW	5	142034537	missense	probably benign	0.00
R1806:Sdk1	UTSW	5	141613195	missense	probably damaging	1.00
R1806:Sdk1	UTSW	5	142161926	missense	probably benign
R1925:Sdk1	UTSW	5	142185285	missense	probably benign	0.09
R1956:Sdk1	UTSW	5	142094581	missense	probably damaging	1.00
R1976:Sdk1	UTSW	5	142143818	missense	probably damaging	1.00
R2124:Sdk1	UTSW	5	142185188	missense	possibly damaging	0.70
R2152:Sdk1	UTSW	5	141792944	missense	probably damaging	1.00
R2186:Sdk1	UTSW	5	142046292	missense	probably benign	0.00
R2187:Sdk1	UTSW	5	142114574	missense	probably damaging	1.00
R2306:Sdk1	UTSW	5	141962700	missense	probably benign	0.00
R2520:Sdk1	UTSW	5	142085771	missense	probably benign	0.19
R2698:Sdk1	UTSW	5	142212050	missense	possibly damaging	0.95
R2763:Sdk1	UTSW	5	142084551	missense	possibly damaging	0.90
R3023:Sdk1	UTSW	5	142046236	missense	probably benign
R3500:Sdk1	UTSW	5	142006616	splice site	probably benign
R3613:Sdk1	UTSW	5	142119686	missense	probably damaging	1.00
R3824:Sdk1	UTSW	5	141936049	missense	probably benign
R3916:Sdk1	UTSW	5	142051244	missense	probably damaging	0.98
R3917:Sdk1	UTSW	5	142051244	missense	probably damaging	0.98
R4158:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4160:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4161:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4386:Sdk1	UTSW	5	142094626	missense	probably damaging	0.99
R4649:Sdk1	UTSW	5	142006625	missense	probably damaging	1.00
R4701:Sdk1	UTSW	5	142185231	missense	probably damaging	1.00
R4780:Sdk1	UTSW	5	141959238	missense	probably damaging	0.97
R4787:Sdk1	UTSW	5	141582413	missense	probably benign
R4825:Sdk1	UTSW	5	141582294	missense	probably benign	0.11
R4853:Sdk1	UTSW	5	142146263	missense	probably damaging	1.00
R4857:Sdk1	UTSW	5	142161776	missense	probably benign	0.01
R4928:Sdk1	UTSW	5	141857003	intron	probably benign
R5111:Sdk1	UTSW	5	142127845	missense	probably damaging	1.00
R5188:Sdk1	UTSW	5	141956260	critical splice donor site	probably null
R5246:Sdk1	UTSW	5	142114562	missense	possibly damaging	0.72
R5273:Sdk1	UTSW	5	141998828	missense	probably damaging	0.99
R5484:Sdk1	UTSW	5	142100186	missense	probably damaging	1.00
R5525:Sdk1	UTSW	5	142185265	missense	possibly damaging	0.84
R5578:Sdk1	UTSW	5	141613125	nonsense	probably null
R5593:Sdk1	UTSW	5	141956124	missense	probably damaging	0.98
R5654:Sdk1	UTSW	5	141936098	missense	probably damaging	0.96
R5672:Sdk1	UTSW	5	142188145	missense	possibly damaging	0.94
R5768:Sdk1	UTSW	5	142143871	missense	probably benign	0.00
R5781:Sdk1	UTSW	5	141936048	missense	probably benign	0.00
R5846:Sdk1	UTSW	5	142114393	missense	probably damaging	1.00
R5851:Sdk1	UTSW	5	141962669	missense	probably benign	0.00
R6164:Sdk1	UTSW	5	142132069	missense	probably damaging	1.00
R6235:Sdk1	UTSW	5	142034426	missense	possibly damaging	0.85
R6364:Sdk1	UTSW	5	141962709	missense	probably benign	0.00
R6453:Sdk1	UTSW	5	142096921	missense	probably damaging	1.00
R6892:Sdk1	UTSW	5	142046298	missense	probably benign	0.00
R6996:Sdk1	UTSW	5	142212014	missense	probably benign	0.16
R7003:Sdk1	UTSW	5	142096734	missense	probably benign	0.01
R7022:Sdk1	UTSW	5	142094657	splice site	probably null
R7027:Sdk1	UTSW	5	142096726	splice site	probably null
R7098:Sdk1	UTSW	5	142096870	missense	probably damaging	0.96
R7107:Sdk1	UTSW	5	142081716	missense	probably damaging	0.99
R7203:Sdk1	UTSW	5	142046176	missense	probably benign	0.08
R7313:Sdk1	UTSW	5	141937622	missense	probably damaging	0.97
R7363:Sdk1	UTSW	5	142188142	missense	probably benign	0.05
R7375:Sdk1	UTSW	5	141998843	missense	probably benign	0.01
R7446:Sdk1	UTSW	5	142144976	missense	probably damaging	1.00
R7527:Sdk1	UTSW	5	141792976	missense	possibly damaging	0.61
R7598:Sdk1	UTSW	5	141609998	nonsense	probably null
R7747:Sdk1	UTSW	5	142084491	missense	probably damaging	1.00
R7810:Sdk1	UTSW	5	141937679	missense	probably benign
R7985:Sdk1	UTSW	5	142127847	missense	probably damaging	1.00
R8129:Sdk1	UTSW	5	142191893	missense	probably benign	0.10
R8217:Sdk1	UTSW	5	142211958	missense	possibly damaging	0.81
R8249:Sdk1	UTSW	5	142188015	critical splice acceptor site	probably null
R8376:Sdk1	UTSW	5	142158621	missense	possibly damaging	0.83
R8779:Sdk1	UTSW	5	141962702	missense	probably benign	0.00
R8807:Sdk1	UTSW	5	142085627	missense	probably damaging	1.00
R8907:Sdk1	UTSW	5	142084523	missense	probably damaging	0.99
R8942:Sdk1	UTSW	5	142096843	missense	probably damaging	1.00
R8945:Sdk1	UTSW	5	141613180	missense	probably benign
R9006:Sdk1	UTSW	5	141937566	missense	probably damaging	1.00
R9249:Sdk1	UTSW	5	142143795	missense	probably damaging	1.00
R9275:Sdk1	UTSW	5	141956198	missense	possibly damaging	0.95
R9345:Sdk1	UTSW	5	142161953	missense	probably benign
R9463:Sdk1	UTSW	5	141962793	missense	probably benign	0.31
R9549:Sdk1	UTSW	5	141954902	missense	possibly damaging	0.95
R9572:Sdk1	UTSW	5	141610029	missense	probably damaging	1.00
R9602:Sdk1	UTSW	5	142085598	missense	probably damaging	0.99
R9703:Sdk1	UTSW	5	142114528	missense	possibly damaging	0.95
R9720:Sdk1	UTSW	5	142212041	missense	probably damaging	0.96
R9771:Sdk1	UTSW	5	142096869	missense	probably damaging	0.99
X0017:Sdk1	UTSW	5	141998780	missense	probably benign	0.00
Z1176:Sdk1	UTSW	5	141959310	missense	probably null	0.58
Z1177:Sdk1	UTSW	5	141962708	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TGACTGTCATACCTCATGCACACAC -3'
(R):5'- TCTGAAGGTGACCATACCCAGAGAG -3'

Sequencing Primer
(F):5'- GGCTGGTTTTCTCCTCAAAAAG -3'
(R):5'- CCAGAGAGGCTCCACAGAG -3'

Posted On

2014-04-13