Incidental Mutation 'R1519:C1galt1'
ID 167268
Institutional Source Beutler Lab
Gene Symbol C1galt1
Ensembl Gene ENSMUSG00000042460
Gene Name core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
Synonyms T-synthase, core 1 beta3-Gal-T, 2210410E06Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1519 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 7844842-7875687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 7866402 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 83 (L83F)
Ref Sequence ENSEMBL: ENSMUSP00000047931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040159]
AlphaFold Q9JJ06
Predicted Effect probably damaging
Transcript: ENSMUST00000040159
AA Change: L83F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047931
Gene: ENSMUSG00000042460
AA Change: L83F

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Fringe 83 283 3e-18 PFAM
Pfam:Galactosyl_T 108 258 6.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203898
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene generates the common core 1 O-glycan structure, Gal-beta-1-3GalNAc-R, by the transfer of Gal from UDP-Gal to GalNAc-alpha-1-R. Core 1 is a precursor for many extended mucin-type O-glycans on cell surface and secreted glycoproteins. Studies in mice suggest that this gene plays a key role in thrombopoiesis and kidney homeostasis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Embryos homozygous for a null allele show impaired angiogenesis, chaotic microvascular networks in brain, and fatal hemorrhage by E14. Eggs homozygous for another null allele show a slightly thinner zona pellucida. Mice homozygous for an ENU-induced allele develop thrombocytopenia and renal disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
9230019H11Rik A G 10: 3,125,230 noncoding transcript Het
9530077C05Rik T G 9: 22,430,375 L114R probably benign Het
Abhd5 T C 9: 122,379,014 probably null Het
Acadvl A G 11: 70,014,791 probably null Het
Actn1 T C 12: 80,205,078 E75G probably damaging Het
Adam4 A T 12: 81,420,877 N323K possibly damaging Het
Anks6 G A 4: 47,027,152 R689W probably damaging Het
Anxa2 T C 9: 69,485,241 I124T probably damaging Het
Aph1c T C 9: 66,833,265 T10A probably benign Het
Arhgap40 T A 2: 158,546,801 W552R probably benign Het
Baz2b C T 2: 59,948,254 R754H possibly damaging Het
Blmh A G 11: 76,966,781 Y147C probably damaging Het
Cd163l1 G A 7: 140,228,156 V747I probably benign Het
Cdh23 A T 10: 60,379,343 Y1403N possibly damaging Het
Cic A T 7: 25,293,810 probably null Het
Coro1b T A 19: 4,150,584 V200D possibly damaging Het
Csl T A 10: 99,757,955 E416V probably damaging Het
Cyp3a25 A G 5: 146,001,447 probably null Het
Dennd2d T A 3: 106,492,559 F266Y probably damaging Het
Dnah10 A G 5: 124,760,952 E1072G probably damaging Het
Dnah6 T A 6: 73,049,048 K3435N probably damaging Het
Dnah9 G A 11: 65,881,761 A3715V probably damaging Het
Fam186a G A 15: 99,947,655 S236L unknown Het
Fam198b A G 3: 79,941,464 N506D possibly damaging Het
Frs3 A G 17: 47,702,978 T199A probably benign Het
Fsd1 A G 17: 55,993,870 N243S probably benign Het
Gabra5 A C 7: 57,408,893 L369R probably benign Het
Gins4 A G 8: 23,234,776 V54A probably benign Het
Gli1 T C 10: 127,334,269 E339G possibly damaging Het
Gm12185 A G 11: 48,907,767 V633A probably damaging Het
Gm8251 A G 1: 44,056,970 V1656A probably benign Het
Gm8765 G A 13: 50,700,407 probably null Het
Gpr83 T A 9: 14,868,197 C182S probably null Het
Gspt1 A G 16: 11,220,855 V627A probably damaging Het
Heatr1 T C 13: 12,412,159 C722R probably benign Het
Jak1 C T 4: 101,162,922 R680Q probably damaging Het
Kif2c A G 4: 117,169,940 V287A probably damaging Het
Kmo A G 1: 175,656,802 E366G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lepr A T 4: 101,789,344 N824I probably damaging Het
Lyrm7 T A 11: 54,848,599 H75L possibly damaging Het
Map4k1 A T 7: 28,991,036 Q351L probably benign Het
Mgam T C 6: 40,661,683 I450T probably benign Het
Nbeal2 A G 9: 110,636,305 L955P probably damaging Het
Nlrp9c T C 7: 26,378,101 K752R possibly damaging Het
Nsmaf A T 4: 6,438,062 I70K probably benign Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr298 A G 7: 86,489,125 M142T probably damaging Het
Otud7a A G 7: 63,758,643 Y898C probably damaging Het
Pcdhb18 A C 18: 37,490,892 D425A probably damaging Het
Prdm1 A T 10: 44,439,986 L733* probably null Het
Prdm2 A T 4: 143,135,583 I379N probably damaging Het
Ptprg A T 14: 12,220,596 Y436F probably damaging Het
Riok3 A G 18: 12,137,306 D167G probably damaging Het
Rnf215 G T 11: 4,135,451 R60L probably damaging Het
Sdk1 A T 5: 141,999,950 H779L probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sh3d21 T A 4: 126,151,726 K387* probably null Het
Slc13a2 T C 11: 78,397,746 Y568C possibly damaging Het
Slc27a5 T C 7: 12,988,459 probably null Het
Slc32a1 T C 2: 158,614,577 L384P probably damaging Het
Sorcs1 T C 19: 50,252,587 N454D probably benign Het
Spag8 T C 4: 43,652,777 Y228C possibly damaging Het
Spc25 T C 2: 69,200,087 I71V probably damaging Het
Tcte1 T A 17: 45,535,252 F261I probably damaging Het
Thsd7a T A 6: 12,471,175 K481N probably benign Het
Tll2 G T 19: 41,086,400 N908K probably benign Het
Tmem236 T C 2: 14,192,280 V93A probably benign Het
Top2b G A 14: 16,408,953 probably null Het
Topaz1 G A 9: 122,767,011 S949N probably benign Het
Triobp A G 15: 78,973,738 T1180A probably benign Het
Trip11 A C 12: 101,886,160 D548E probably benign Het
Trpv2 T A 11: 62,589,826 probably null Het
Vmn1r12 T A 6: 57,159,555 H212Q probably damaging Het
Vmn2r112 A G 17: 22,618,903 T782A possibly damaging Het
Vmn2r7 A G 3: 64,716,455 V239A possibly damaging Het
Vmn2r80 T A 10: 79,194,219 N626K probably damaging Het
Vmn2r99 A G 17: 19,380,060 S449G probably benign Het
Wfikkn2 T C 11: 94,238,107 T403A probably benign Het
Xirp2 A G 2: 67,515,679 I2755V probably benign Het
Yjefn3 A G 8: 69,889,079 V153A probably benign Het
Zfp677 C A 17: 21,397,237 H185Q possibly damaging Het
Zfp947 C T 17: 22,146,292 V134I probably benign Het
Other mutations in C1galt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:C1galt1 APN 6 7866475 missense probably damaging 0.98
PIT4378001:C1galt1 UTSW 6 7863944 missense probably benign 0.01
R0086:C1galt1 UTSW 6 7867051 splice site probably benign
R0540:C1galt1 UTSW 6 7871193 missense probably benign 0.00
R0567:C1galt1 UTSW 6 7866874 missense probably damaging 1.00
R0607:C1galt1 UTSW 6 7871193 missense probably benign 0.00
R1712:C1galt1 UTSW 6 7871217 missense probably benign
R2989:C1galt1 UTSW 6 7866622 missense possibly damaging 0.50
R3035:C1galt1 UTSW 6 7866762 missense probably benign 0.06
R4271:C1galt1 UTSW 6 7866607 missense probably damaging 1.00
R4749:C1galt1 UTSW 6 7866379 missense probably benign 0.42
R5029:C1galt1 UTSW 6 7863931 missense possibly damaging 0.95
R5393:C1galt1 UTSW 6 7864143 critical splice donor site probably null
R5448:C1galt1 UTSW 6 7866658 missense possibly damaging 0.95
R7055:C1galt1 UTSW 6 7866585 missense probably damaging 1.00
R7319:C1galt1 UTSW 6 7871150 missense probably damaging 1.00
R8887:C1galt1 UTSW 6 7866379 missense probably benign 0.42
R9355:C1galt1 UTSW 6 7866474 missense probably damaging 1.00
R9755:C1galt1 UTSW 6 7867019 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCAGGTCACATTAGCTTGTGCCC -3'
(R):5'- CTTCCTTGCTTAGGACATAGCCCG -3'

Sequencing Primer
(F):5'- AGCTTGTGCCCATTTATCAAAGTC -3'
(R):5'- AGAAGCCATCTCAGGTTGTC -3'
Posted On 2014-04-13