Mutagenetix > Incidental Mutation

Incidental Mutation 'R1519:Thsd7a'

167269

Institutional Source

Beutler Lab

Gene Symbol

Thsd7a

Ensembl Gene

ENSMUSG00000032625

Gene Name

thrombospondin, type I, domain containing 7A

Synonyms

LOC330267

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1519 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12311610-12749410 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12471175 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 481 (K481N)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000046121
AA Change: K481N

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000040176
Gene: ENSMUSG00000032625
AA Change: K481N

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.2e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119443

SMART Domains

Protein: ENSMUSP00000113780
Gene: ENSMUSG00000032625

Domain	Start	End	E-Value	Type
TSP1	14	70	9.98e-5	SMART
TSP1	77	161	3.14e0	SMART
TSP1	166	225	6.62e-1	SMART
Blast:TSP1	226	262	1e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000119581
AA Change: K481N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: K481N

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1082	9.09e-8	SMART
TSP1	1085	1150	5.82e-1	SMART
TSP1	1155	1207	4.24e-2	SMART
TSP1	1210	1271	1e0	SMART
TSP1	1276	1328	3.55e-10	SMART
TSP1	1329	1399	7.5e-2	SMART
TSP1	1404	1462	1.55e-1	SMART
transmembrane domain	1594	1616	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172356
AA Change: K481N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: K481N

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.95e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	C	G	10: 100,603,528	P187R	probably damaging	Het
9230019H11Rik	A	G	10: 3,125,230		noncoding transcript	Het
9530077C05Rik	T	G	9: 22,430,375	L114R	probably benign	Het
Abhd5	T	C	9: 122,379,014		probably null	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Actn1	T	C	12: 80,205,078	E75G	probably damaging	Het
Adam4	A	T	12: 81,420,877	N323K	possibly damaging	Het
Anks6	G	A	4: 47,027,152	R689W	probably damaging	Het
Anxa2	T	C	9: 69,485,241	I124T	probably damaging	Het
Aph1c	T	C	9: 66,833,265	T10A	probably benign	Het
Arhgap40	T	A	2: 158,546,801	W552R	probably benign	Het
Baz2b	C	T	2: 59,948,254	R754H	possibly damaging	Het
Blmh	A	G	11: 76,966,781	Y147C	probably damaging	Het
C1galt1	C	T	6: 7,866,402	L83F	probably damaging	Het
Cd163l1	G	A	7: 140,228,156	V747I	probably benign	Het
Cdh23	A	T	10: 60,379,343	Y1403N	possibly damaging	Het
Cic	A	T	7: 25,293,810		probably null	Het
Coro1b	T	A	19: 4,150,584	V200D	possibly damaging	Het
Csl	T	A	10: 99,757,955	E416V	probably damaging	Het
Cyp3a25	A	G	5: 146,001,447		probably null	Het
Dennd2d	T	A	3: 106,492,559	F266Y	probably damaging	Het
Dnah10	A	G	5: 124,760,952	E1072G	probably damaging	Het
Dnah6	T	A	6: 73,049,048	K3435N	probably damaging	Het
Dnah9	G	A	11: 65,881,761	A3715V	probably damaging	Het
Fam186a	G	A	15: 99,947,655	S236L	unknown	Het
Fam198b	A	G	3: 79,941,464	N506D	possibly damaging	Het
Frs3	A	G	17: 47,702,978	T199A	probably benign	Het
Fsd1	A	G	17: 55,993,870	N243S	probably benign	Het
Gabra5	A	C	7: 57,408,893	L369R	probably benign	Het
Gins4	A	G	8: 23,234,776	V54A	probably benign	Het
Gli1	T	C	10: 127,334,269	E339G	possibly damaging	Het
Gm12185	A	G	11: 48,907,767	V633A	probably damaging	Het
Gm8251	A	G	1: 44,056,970	V1656A	probably benign	Het
Gm8765	G	A	13: 50,700,407		probably null	Het
Gpr83	T	A	9: 14,868,197	C182S	probably null	Het
Gspt1	A	G	16: 11,220,855	V627A	probably damaging	Het
Heatr1	T	C	13: 12,412,159	C722R	probably benign	Het
Jak1	C	T	4: 101,162,922	R680Q	probably damaging	Het
Kif2c	A	G	4: 117,169,940	V287A	probably damaging	Het
Kmo	C	T	1: 175,651,618	P240L	possibly damaging	Het
Kmo	A	G	1: 175,656,802	E366G	probably damaging	Het
Lepr	A	T	4: 101,789,344	N824I	probably damaging	Het
Lyrm7	T	A	11: 54,848,599	H75L	possibly damaging	Het
Map4k1	A	T	7: 28,991,036	Q351L	probably benign	Het
Mgam	T	C	6: 40,661,683	I450T	probably benign	Het
Nbeal2	A	G	9: 110,636,305	L955P	probably damaging	Het
Nlrp9c	T	C	7: 26,378,101	K752R	possibly damaging	Het
Nsmaf	A	T	4: 6,438,062	I70K	probably benign	Het
Olfr201	C	T	16: 59,268,944	C241Y	probably damaging	Het
Olfr298	A	G	7: 86,489,125	M142T	probably damaging	Het
Otud7a	A	G	7: 63,758,643	Y898C	probably damaging	Het
Pcdhb18	A	C	18: 37,490,892	D425A	probably damaging	Het
Prdm1	A	T	10: 44,439,986	L733*	probably null	Het
Prdm2	A	T	4: 143,135,583	I379N	probably damaging	Het
Ptprg	A	T	14: 12,220,596	Y436F	probably damaging	Het
Riok3	A	G	18: 12,137,306	D167G	probably damaging	Het
Rnf215	G	T	11: 4,135,451	R60L	probably damaging	Het
Sdk1	A	T	5: 141,999,950	H779L	probably benign	Het
Serpine2	A	G	1: 79,795,031	F390L	probably damaging	Het
Sh3d21	T	A	4: 126,151,726	K387*	probably null	Het
Slc13a2	T	C	11: 78,397,746	Y568C	possibly damaging	Het
Slc27a5	T	C	7: 12,988,459		probably null	Het
Slc32a1	T	C	2: 158,614,577	L384P	probably damaging	Het
Sorcs1	T	C	19: 50,252,587	N454D	probably benign	Het
Spag8	T	C	4: 43,652,777	Y228C	possibly damaging	Het
Spc25	T	C	2: 69,200,087	I71V	probably damaging	Het
Tcte1	T	A	17: 45,535,252	F261I	probably damaging	Het
Tll2	G	T	19: 41,086,400	N908K	probably benign	Het
Tmem236	T	C	2: 14,192,280	V93A	probably benign	Het
Top2b	G	A	14: 16,408,953		probably null	Het
Topaz1	G	A	9: 122,767,011	S949N	probably benign	Het
Triobp	A	G	15: 78,973,738	T1180A	probably benign	Het
Trip11	A	C	12: 101,886,160	D548E	probably benign	Het
Trpv2	T	A	11: 62,589,826		probably null	Het
Vmn1r12	T	A	6: 57,159,555	H212Q	probably damaging	Het
Vmn2r112	A	G	17: 22,618,903	T782A	possibly damaging	Het
Vmn2r7	A	G	3: 64,716,455	V239A	possibly damaging	Het
Vmn2r80	T	A	10: 79,194,219	N626K	probably damaging	Het
Vmn2r99	A	G	17: 19,380,060	S449G	probably benign	Het
Wfikkn2	T	C	11: 94,238,107	T403A	probably benign	Het
Xirp2	A	G	2: 67,515,679	I2755V	probably benign	Het
Yjefn3	A	G	8: 69,889,079	V153A	probably benign	Het
Zfp677	C	A	17: 21,397,237	H185Q	possibly damaging	Het
Zfp947	C	T	17: 22,146,292	V134I	probably benign	Het

Other mutations in Thsd7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Thsd7a	APN	6	12379659	splice site	probably null
IGL00563:Thsd7a	APN	6	12379659	splice site	probably null
IGL00753:Thsd7a	APN	6	12327529	missense	probably damaging	1.00
IGL00835:Thsd7a	APN	6	12554934	missense	probably damaging	1.00
IGL01486:Thsd7a	APN	6	12471080	missense	probably damaging	1.00
IGL01730:Thsd7a	APN	6	12554981	missense	probably benign	0.05
IGL01931:Thsd7a	APN	6	12504099	missense	probably damaging	1.00
IGL01935:Thsd7a	APN	6	12317419	missense	probably damaging	1.00
IGL01978:Thsd7a	APN	6	12331006	missense	probably benign	0.01
IGL02233:Thsd7a	APN	6	12555258	missense	probably benign	0.00
IGL02354:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02361:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02375:Thsd7a	APN	6	12343265	missense	probably damaging	1.00
IGL02468:Thsd7a	APN	6	12318171	missense	probably damaging	0.98
IGL02616:Thsd7a	APN	6	12408985	missense	probably damaging	0.98
IGL02820:Thsd7a	APN	6	12321072	missense	probably damaging	1.00
IGL02858:Thsd7a	APN	6	12500995	missense	probably benign	0.16
IGL03074:Thsd7a	APN	6	12324681	missense	probably damaging	0.99
IGL03234:Thsd7a	APN	6	12343178	missense	probably damaging	1.00
IGL03244:Thsd7a	APN	6	12504168	splice site	probably benign
IGL03337:Thsd7a	APN	6	12405174	missense	probably damaging	1.00
G1patch:Thsd7a	UTSW	6	12555631	missense	possibly damaging	0.87
PIT4354001:Thsd7a	UTSW	6	12331927	critical splice donor site	probably null
R0095:Thsd7a	UTSW	6	12320970	missense	probably damaging	0.99
R0127:Thsd7a	UTSW	6	12554908	missense	probably benign	0.01
R0142:Thsd7a	UTSW	6	12418335	missense	probably damaging	1.00
R0226:Thsd7a	UTSW	6	12321900	missense	possibly damaging	0.94
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0359:Thsd7a	UTSW	6	12352031	missense	probably damaging	1.00
R0365:Thsd7a	UTSW	6	12321887	critical splice donor site	probably null
R0504:Thsd7a	UTSW	6	12379594	missense	probably damaging	0.99
R0512:Thsd7a	UTSW	6	12379605	missense	possibly damaging	0.67
R0540:Thsd7a	UTSW	6	12331542	splice site	probably null
R0577:Thsd7a	UTSW	6	12321048	missense	possibly damaging	0.50
R0607:Thsd7a	UTSW	6	12331542	splice site	probably null
R0755:Thsd7a	UTSW	6	12555369	missense	probably damaging	1.00
R0771:Thsd7a	UTSW	6	12327577	missense	probably benign	0.09
R0780:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0870:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0871:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0872:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0873:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R1102:Thsd7a	UTSW	6	12555702	missense	possibly damaging	0.58
R1144:Thsd7a	UTSW	6	12471027	splice site	probably benign
R1265:Thsd7a	UTSW	6	12317419	missense	probably damaging	0.99
R1276:Thsd7a	UTSW	6	12418370	missense	probably damaging	1.00
R1381:Thsd7a	UTSW	6	12555439	missense	probably damaging	1.00
R1473:Thsd7a	UTSW	6	12338622	missense	probably benign	0.08
R1633:Thsd7a	UTSW	6	12471104	nonsense	probably null
R1659:Thsd7a	UTSW	6	12504064	missense	possibly damaging	0.73
R1769:Thsd7a	UTSW	6	12555715	nonsense	probably null
R1824:Thsd7a	UTSW	6	12409042	splice site	probably null
R1840:Thsd7a	UTSW	6	12330974	missense	probably benign	0.03
R1845:Thsd7a	UTSW	6	12321041	missense	probably damaging	1.00
R1874:Thsd7a	UTSW	6	12555435	missense	possibly damaging	0.76
R2023:Thsd7a	UTSW	6	12327536	missense	probably benign	0.16
R2039:Thsd7a	UTSW	6	12408923	missense	possibly damaging	0.77
R2058:Thsd7a	UTSW	6	12318106	splice site	probably benign
R2138:Thsd7a	UTSW	6	12471073	nonsense	probably null
R2155:Thsd7a	UTSW	6	12379633	missense	probably damaging	1.00
R2175:Thsd7a	UTSW	6	12331944	missense	possibly damaging	0.95
R2216:Thsd7a	UTSW	6	12337268	missense	possibly damaging	0.95
R2318:Thsd7a	UTSW	6	12405147	missense	probably damaging	1.00
R2375:Thsd7a	UTSW	6	12337362	missense	probably damaging	1.00
R3857:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3858:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3890:Thsd7a	UTSW	6	12418337	missense	probably benign	0.09
R3910:Thsd7a	UTSW	6	12331549	missense	probably damaging	0.96
R3933:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R4369:Thsd7a	UTSW	6	12468908	missense	probably damaging	1.00
R4447:Thsd7a	UTSW	6	12324635	missense	probably damaging	0.98
R4664:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4664:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4665:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4665:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4666:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4666:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4668:Thsd7a	UTSW	6	12408968	missense	probably damaging	0.98
R4886:Thsd7a	UTSW	6	12327660	nonsense	probably null
R4918:Thsd7a	UTSW	6	12327559	missense	probably damaging	1.00
R4938:Thsd7a	UTSW	6	12330992	missense	probably benign	0.09
R5064:Thsd7a	UTSW	6	12330952	missense	possibly damaging	0.66
R5153:Thsd7a	UTSW	6	12338655	missense	probably benign	0.00
R5177:Thsd7a	UTSW	6	12379583	nonsense	probably null
R5242:Thsd7a	UTSW	6	12327583	missense	probably damaging	1.00
R5267:Thsd7a	UTSW	6	12379602	missense	probably damaging	1.00
R5442:Thsd7a	UTSW	6	12748800	missense	probably benign	0.00
R5506:Thsd7a	UTSW	6	12332017	missense	possibly damaging	0.85
R5525:Thsd7a	UTSW	6	12332007	missense	possibly damaging	0.52
R5544:Thsd7a	UTSW	6	12379471	missense	possibly damaging	0.94
R5651:Thsd7a	UTSW	6	12343213	missense	probably damaging	1.00
R5716:Thsd7a	UTSW	6	12343148	missense	probably benign	0.00
R5848:Thsd7a	UTSW	6	12503923	missense	probably damaging	1.00
R5958:Thsd7a	UTSW	6	12337262	missense	probably benign	0.02
R6012:Thsd7a	UTSW	6	12379389	splice site	probably null
R6139:Thsd7a	UTSW	6	12379573	missense	possibly damaging	0.93
R6243:Thsd7a	UTSW	6	12327602	missense	probably damaging	1.00
R6257:Thsd7a	UTSW	6	12408988	nonsense	probably null
R6273:Thsd7a	UTSW	6	12408836	missense	probably damaging	0.99
R6300:Thsd7a	UTSW	6	12471104	nonsense	probably null
R6314:Thsd7a	UTSW	6	12554997	missense	possibly damaging	0.87
R6392:Thsd7a	UTSW	6	12468929	missense	probably damaging	0.99
R6418:Thsd7a	UTSW	6	12555082	nonsense	probably null
R6515:Thsd7a	UTSW	6	12501086	missense	possibly damaging	0.47
R6725:Thsd7a	UTSW	6	12555631	missense	possibly damaging	0.87
R6742:Thsd7a	UTSW	6	12408816	missense	probably damaging	1.00
R6776:Thsd7a	UTSW	6	12555637	missense	possibly damaging	0.53
R6838:Thsd7a	UTSW	6	12504075	missense	probably damaging	0.99
R7104:Thsd7a	UTSW	6	12379430	missense
R7170:Thsd7a	UTSW	6	12352091	missense
R7349:Thsd7a	UTSW	6	12352068	missense
R7460:Thsd7a	UTSW	6	12554934	missense
R7467:Thsd7a	UTSW	6	12331585	missense
R7666:Thsd7a	UTSW	6	12379438	missense
R7869:Thsd7a	UTSW	6	12471124	nonsense	probably null
R8032:Thsd7a	UTSW	6	12555288	missense
R8165:Thsd7a	UTSW	6	12468963	missense
R8167:Thsd7a	UTSW	6	12317401	nonsense	probably null
R8245:Thsd7a	UTSW	6	12379593	missense
R8310:Thsd7a	UTSW	6	12396613	missense
R8312:Thsd7a	UTSW	6	12471182	missense
R8331:Thsd7a	UTSW	6	12471158	missense
R8755:Thsd7a	UTSW	6	12408852	nonsense	probably null
R8843:Thsd7a	UTSW	6	12501137	missense
R8867:Thsd7a	UTSW	6	12338687	missense
R8952:Thsd7a	UTSW	6	12468993	missense	probably damaging	0.98
R9036:Thsd7a	UTSW	6	12418250	missense
R9299:Thsd7a	UTSW	6	12504132	missense
R9366:Thsd7a	UTSW	6	12555481	missense
R9489:Thsd7a	UTSW	6	12352023	missense

Predicted Primers

PCR Primer
(F):5'- CAAAACTGCCTTAATTGGTGGGTGTTG -3'
(R):5'- CCAAGCACTTCATCAGACTTCTAGTCC -3'

Sequencing Primer
(F):5'- TGTAAACAGGTCATGTCAACATCAC -3'
(R):5'- TCAGACTTCTAGTCCAGTTTTATTTG -3'

Posted On

2014-04-13