Mutagenetix > Incidental Mutations

Incidental Mutation 'R1519:Nbeal2'

167291

Institutional Source

Beutler Lab

Gene Symbol

Nbeal2

Ensembl Gene

ENSMUSG00000056724

Gene Name

neurobeachin-like 2

Synonyms

1110014F23Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.252) question?

Stock #

R1519 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110624789-110654161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110636305 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 955 (L955P)

Ref Sequence

ENSEMBL: ENSMUSP00000143265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000133191] [ENSMUST00000149089] [ENSMUST00000167320] [ENSMUST00000196488]

Predicted Effect

probably benign
Transcript: ENSMUST00000123996

Predicted Effect

unknown
Transcript: ENSMUST00000130024
AA Change: L454P

SMART Domains

Protein: ENSMUSP00000118061
Gene: ENSMUSG00000056724
AA Change: L454P

Domain	Start	End	E-Value	Type
low complexity region	1	13	N/A	INTRINSIC
low complexity region	236	248	N/A	INTRINSIC
Pfam:DUF4704	345	607	2.5e-29	PFAM
low complexity region	649	664	N/A	INTRINSIC
low complexity region	804	819	N/A	INTRINSIC
Pfam:DUF4800	872	1138	9.9e-113	PFAM
low complexity region	1164	1193	N/A	INTRINSIC
Pfam:PH_BEACH	1204	1291	2.2e-21	PFAM
Beach	1343	1623	5.2e-205	SMART
WD40	1721	1766	1.03e1	SMART
WD40	1769	1808	6.19e-5	SMART
WD40	1820	1859	1.02e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131017

SMART Domains

Protein: ENSMUSP00000114660
Gene: ENSMUSG00000056724

Domain	Start	End	E-Value	Type
Pfam:DUF4800	1	209	7.5e-97	PFAM
low complexity region	235	264	N/A	INTRINSIC
Pfam:PH_BEACH	275	362	1e-21	PFAM
Beach	414	694	5.2e-205	SMART
WD40	762	807	1.03e1	SMART
WD40	810	849	6.19e-5	SMART
WD40	861	900	1.02e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000133191
AA Change: L982P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724
AA Change: L982P

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
Pfam:Laminin_G_3	578	818	5.9e-8	PFAM
low complexity region	1014	1028	N/A	INTRINSIC
low complexity region	1128	1136	N/A	INTRINSIC
low complexity region	1149	1163	N/A	INTRINSIC
low complexity region	1359	1375	N/A	INTRINSIC
low complexity region	1515	1530	N/A	INTRINSIC
low complexity region	1621	1647	N/A	INTRINSIC
low complexity region	1875	1904	N/A	INTRINSIC
Pfam:PH_BEACH	1908	2002	6.2e-28	PFAM
Beach	2054	2334	5.2e-205	SMART
WD40	2432	2477	1.03e1	SMART
WD40	2480	2519	6.19e-5	SMART
WD40	2531	2570	1.02e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138072

Predicted Effect

probably benign
Transcript: ENSMUST00000149089

SMART Domains

Protein: ENSMUSP00000119254
Gene: ENSMUSG00000056724

Domain	Start	End	E-Value	Type
low complexity region	49	77	N/A	INTRINSIC
low complexity region	185	194	N/A	INTRINSIC
low complexity region	220	231	N/A	INTRINSIC
low complexity region	480	488	N/A	INTRINSIC
low complexity region	493	508	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153960

Predicted Effect

probably damaging
Transcript: ENSMUST00000167320
AA Change: L982P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724
AA Change: L982P

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	763	775	N/A	INTRINSIC
Pfam:DUF4704	872	1148	9.2e-32	PFAM
low complexity region	1149	1163	N/A	INTRINSIC
low complexity region	1366	1382	N/A	INTRINSIC
low complexity region	1522	1537	N/A	INTRINSIC
Pfam:DUF4800	1590	1856	1.5e-112	PFAM
low complexity region	1882	1911	N/A	INTRINSIC
Pfam:PH_BEACH	1922	2009	3.1e-21	PFAM
Beach	2061	2341	5.2e-205	SMART
WD40	2439	2484	1.03e1	SMART
WD40	2487	2526	6.19e-5	SMART
WD40	2538	2577	1.02e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184024

Predicted Effect

probably damaging
Transcript: ENSMUST00000196488
AA Change: L955P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724
AA Change: L955P

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	487	495	N/A	INTRINSIC
low complexity region	500	515	N/A	INTRINSIC
Pfam:Laminin_G_3	551	791	5.3e-6	PFAM
low complexity region	987	1001	N/A	INTRINSIC
low complexity region	1101	1109	N/A	INTRINSIC
low complexity region	1122	1136	N/A	INTRINSIC
low complexity region	1332	1348	N/A	INTRINSIC
low complexity region	1488	1503	N/A	INTRINSIC
low complexity region	1594	1620	N/A	INTRINSIC
low complexity region	1848	1877	N/A	INTRINSIC
Pfam:PH_BEACH	1881	1975	3.1e-25	PFAM
Beach	2027	2307	3.8e-209	SMART
WD40	2405	2450	6.3e-2	SMART
WD40	2453	2492	3.8e-7	SMART
WD40	2504	2543	6.5e-8	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice exhibit megakaryocyte and platelet abnormalities resulting in impaired arterial thrombus formation and protection from infarction following cerebral ischemia. Wound repair is impaired. These abnormalities result in a bleeding disorder similiar to Gray Platelet Syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	C	G	10: 100,603,528	P187R	probably damaging	Het
9230019H11Rik	A	G	10: 3,125,230		noncoding transcript	Het
9530077C05Rik	T	G	9: 22,430,375	L114R	probably benign	Het
Abhd5	T	C	9: 122,379,014		probably null	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Actn1	T	C	12: 80,205,078	E75G	probably damaging	Het
Adam4	A	T	12: 81,420,877	N323K	possibly damaging	Het
Anks6	G	A	4: 47,027,152	R689W	probably damaging	Het
Anxa2	T	C	9: 69,485,241	I124T	probably damaging	Het
Aph1c	T	C	9: 66,833,265	T10A	probably benign	Het
Arhgap40	T	A	2: 158,546,801	W552R	probably benign	Het
Baz2b	C	T	2: 59,948,254	R754H	possibly damaging	Het
Blmh	A	G	11: 76,966,781	Y147C	probably damaging	Het
C1galt1	C	T	6: 7,866,402	L83F	probably damaging	Het
Cd163l1	G	A	7: 140,228,156	V747I	probably benign	Het
Cdh23	A	T	10: 60,379,343	Y1403N	possibly damaging	Het
Cic	A	T	7: 25,293,810		probably null	Het
Coro1b	T	A	19: 4,150,584	V200D	possibly damaging	Het
Csl	T	A	10: 99,757,955	E416V	probably damaging	Het
Cyp3a25	A	G	5: 146,001,447		probably null	Het
Dennd2d	T	A	3: 106,492,559	F266Y	probably damaging	Het
Dnah10	A	G	5: 124,760,952	E1072G	probably damaging	Het
Dnah6	T	A	6: 73,049,048	K3435N	probably damaging	Het
Dnah9	G	A	11: 65,881,761	A3715V	probably damaging	Het
Fam186a	G	A	15: 99,947,655	S236L	unknown	Het
Fam198b	A	G	3: 79,941,464	N506D	possibly damaging	Het
Frs3	A	G	17: 47,702,978	T199A	probably benign	Het
Fsd1	A	G	17: 55,993,870	N243S	probably benign	Het
Gabra5	A	C	7: 57,408,893	L369R	probably benign	Het
Gins4	A	G	8: 23,234,776	V54A	probably benign	Het
Gli1	T	C	10: 127,334,269	E339G	possibly damaging	Het
Gm12185	A	G	11: 48,907,767	V633A	probably damaging	Het
Gm8251	A	G	1: 44,056,970	V1656A	probably benign	Het
Gm8765	G	A	13: 50,700,407		probably null	Het
Gpr83	T	A	9: 14,868,197	C182S	probably null	Het
Gspt1	A	G	16: 11,220,855	V627A	probably damaging	Het
Heatr1	T	C	13: 12,412,159	C722R	probably benign	Het
Jak1	C	T	4: 101,162,922	R680Q	probably damaging	Het
Kif2c	A	G	4: 117,169,940	V287A	probably damaging	Het
Kmo	C	T	1: 175,651,618	P240L	possibly damaging	Het
Kmo	A	G	1: 175,656,802	E366G	probably damaging	Het
Lepr	A	T	4: 101,789,344	N824I	probably damaging	Het
Lyrm7	T	A	11: 54,848,599	H75L	possibly damaging	Het
Map4k1	A	T	7: 28,991,036	Q351L	probably benign	Het
Mgam	T	C	6: 40,661,683	I450T	probably benign	Het
Nlrp9c	T	C	7: 26,378,101	K752R	possibly damaging	Het
Nsmaf	A	T	4: 6,438,062	I70K	probably benign	Het
Olfr201	C	T	16: 59,268,944	C241Y	probably damaging	Het
Olfr298	A	G	7: 86,489,125	M142T	probably damaging	Het
Otud7a	A	G	7: 63,758,643	Y898C	probably damaging	Het
Pcdhb18	A	C	18: 37,490,892	D425A	probably damaging	Het
Prdm1	A	T	10: 44,439,986	L733*	probably null	Het
Prdm2	A	T	4: 143,135,583	I379N	probably damaging	Het
Ptprg	A	T	14: 12,220,596	Y436F	probably damaging	Het
Riok3	A	G	18: 12,137,306	D167G	probably damaging	Het
Rnf215	G	T	11: 4,135,451	R60L	probably damaging	Het
Sdk1	A	T	5: 141,999,950	H779L	probably benign	Het
Serpine2	A	G	1: 79,795,031	F390L	probably damaging	Het
Sh3d21	T	A	4: 126,151,726	K387*	probably null	Het
Slc13a2	T	C	11: 78,397,746	Y568C	possibly damaging	Het
Slc27a5	T	C	7: 12,988,459		probably null	Het
Slc32a1	T	C	2: 158,614,577	L384P	probably damaging	Het
Sorcs1	T	C	19: 50,252,587	N454D	probably benign	Het
Spag8	T	C	4: 43,652,777	Y228C	possibly damaging	Het
Spc25	T	C	2: 69,200,087	I71V	probably damaging	Het
Tcte1	T	A	17: 45,535,252	F261I	probably damaging	Het
Thsd7a	T	A	6: 12,471,175	K481N	probably benign	Het
Tll2	G	T	19: 41,086,400	N908K	probably benign	Het
Tmem236	T	C	2: 14,192,280	V93A	probably benign	Het
Top2b	G	A	14: 16,408,953		probably null	Het
Topaz1	G	A	9: 122,767,011	S949N	probably benign	Het
Triobp	A	G	15: 78,973,738	T1180A	probably benign	Het
Trip11	A	C	12: 101,886,160	D548E	probably benign	Het
Trpv2	T	A	11: 62,589,826		probably null	Het
Vmn1r12	T	A	6: 57,159,555	H212Q	probably damaging	Het
Vmn2r112	A	G	17: 22,618,903	T782A	possibly damaging	Het
Vmn2r7	A	G	3: 64,716,455	V239A	possibly damaging	Het
Vmn2r80	T	A	10: 79,194,219	N626K	probably damaging	Het
Vmn2r99	A	G	17: 19,380,060	S449G	probably benign	Het
Wfikkn2	T	C	11: 94,238,107	T403A	probably benign	Het
Xirp2	A	G	2: 67,515,679	I2755V	probably benign	Het
Yjefn3	A	G	8: 69,889,079	V153A	probably benign	Het
Zfp677	C	A	17: 21,397,237	H185Q	possibly damaging	Het
Zfp947	C	T	17: 22,146,292	V134I	probably benign	Het

Other mutations in Nbeal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Nbeal2	APN	9	110635869	missense	probably damaging	1.00
IGL00784:Nbeal2	APN	9	110629763	splice site	probably benign
IGL00826:Nbeal2	APN	9	110626903	missense	probably benign
IGL00885:Nbeal2	APN	9	110638661	missense	probably damaging	1.00
IGL01348:Nbeal2	APN	9	110629146	missense	probably damaging	0.99
IGL01511:Nbeal2	APN	9	110629234	missense	probably damaging	1.00
IGL01571:Nbeal2	APN	9	110632758	missense	possibly damaging	0.63
IGL01612:Nbeal2	APN	9	110644678	missense	probably damaging	1.00
IGL01924:Nbeal2	APN	9	110631414	missense	probably benign	0.23
IGL02056:Nbeal2	APN	9	110627324	missense	probably benign	0.17
IGL02481:Nbeal2	APN	9	110625995	nonsense	probably null
IGL02483:Nbeal2	APN	9	110625995	nonsense	probably null
IGL02502:Nbeal2	APN	9	110633768	missense	probably damaging	1.00
IGL02631:Nbeal2	APN	9	110630208	missense	probably damaging	0.99
IGL02637:Nbeal2	APN	9	110625977	missense	possibly damaging	0.62
IGL02727:Nbeal2	APN	9	110639285	splice site	probably benign
IGL02887:Nbeal2	APN	9	110628276	missense	probably damaging	1.00
IGL02896:Nbeal2	APN	9	110639292	critical splice donor site	probably null
IGL03110:Nbeal2	APN	9	110631433	missense	probably damaging	1.00
Antonym	UTSW	9	110630252	missense	probably damaging	1.00
dog	UTSW	9	110635341	missense	possibly damaging	0.89
legion	UTSW	9	110629179	missense	probably damaging	1.00
litigious	UTSW	9	110628195	missense	probably damaging	1.00
mall	UTSW	9	110632886	missense	probably damaging	1.00
Mollusca	UTSW	9	110645438	splice site	probably null
Schleuter	UTSW	9	110628744	missense	possibly damaging	0.69
shellfish	UTSW	9	110628720	missense	probably damaging	1.00
F5770:Nbeal2	UTSW	9	110637937	missense	possibly damaging	0.65
R0032:Nbeal2	UTSW	9	110637868	splice site	probably benign
R0084:Nbeal2	UTSW	9	110643710	critical splice donor site	probably null
R0147:Nbeal2	UTSW	9	110642143	nonsense	probably null
R0294:Nbeal2	UTSW	9	110632859	missense	probably damaging	1.00
R0310:Nbeal2	UTSW	9	110638163	missense	probably damaging	1.00
R0494:Nbeal2	UTSW	9	110627187	missense	probably damaging	1.00
R0550:Nbeal2	UTSW	9	110642158	missense	probably benign	0.01
R0630:Nbeal2	UTSW	9	110636034	splice site	probably benign
R0762:Nbeal2	UTSW	9	110643808	splice site	probably benign
R0862:Nbeal2	UTSW	9	110628195	missense	probably damaging	1.00
R0864:Nbeal2	UTSW	9	110628195	missense	probably damaging	1.00
R1225:Nbeal2	UTSW	9	110632886	missense	probably damaging	1.00
R1240:Nbeal2	UTSW	9	110627108	missense	probably damaging	0.98
R1450:Nbeal2	UTSW	9	110633672	splice site	probably benign
R1655:Nbeal2	UTSW	9	110632872	missense	probably damaging	1.00
R1668:Nbeal2	UTSW	9	110638893	missense	probably damaging	1.00
R1705:Nbeal2	UTSW	9	110625196	missense	probably damaging	1.00
R1784:Nbeal2	UTSW	9	110630857	nonsense	probably null
R1834:Nbeal2	UTSW	9	110627129	missense	probably damaging	1.00
R1997:Nbeal2	UTSW	9	110632198	missense	probably damaging	1.00
R2013:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2014:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2055:Nbeal2	UTSW	9	110635307	missense	possibly damaging	0.92
R2086:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2113:Nbeal2	UTSW	9	110625406	missense	probably damaging	1.00
R2167:Nbeal2	UTSW	9	110638308	missense	probably damaging	1.00
R2201:Nbeal2	UTSW	9	110630250	missense	probably benign	0.16
R2309:Nbeal2	UTSW	9	110626570	missense	probably damaging	1.00
R2378:Nbeal2	UTSW	9	110630808	missense	probably damaging	0.99
R2945:Nbeal2	UTSW	9	110628068	missense	possibly damaging	0.82
R3052:Nbeal2	UTSW	9	110633085	missense	possibly damaging	0.93
R3076:Nbeal2	UTSW	9	110631700	missense	probably damaging	1.00
R3176:Nbeal2	UTSW	9	110636887	splice site	probably benign
R3974:Nbeal2	UTSW	9	110633846	missense	probably damaging	1.00
R4183:Nbeal2	UTSW	9	110636675	missense	probably benign
R4342:Nbeal2	UTSW	9	110631793	intron	probably benign
R4654:Nbeal2	UTSW	9	110632004	missense	probably damaging	1.00
R4707:Nbeal2	UTSW	9	110632055	missense	probably benign	0.10
R4822:Nbeal2	UTSW	9	110636315	missense	possibly damaging	0.82
R4854:Nbeal2	UTSW	9	110631396	missense	probably damaging	1.00
R4860:Nbeal2	UTSW	9	110635194	missense	probably benign	0.00
R4860:Nbeal2	UTSW	9	110635194	missense	probably benign	0.00
R4990:Nbeal2	UTSW	9	110634803	missense	probably benign	0.10
R4991:Nbeal2	UTSW	9	110638767	missense	probably damaging	1.00
R5021:Nbeal2	UTSW	9	110637463	missense	probably damaging	0.99
R5057:Nbeal2	UTSW	9	110631005	missense	probably damaging	1.00
R5092:Nbeal2	UTSW	9	110626728	splice site	probably null
R5161:Nbeal2	UTSW	9	110629868	missense	probably benign
R5202:Nbeal2	UTSW	9	110644666	missense	probably damaging	0.99
R5217:Nbeal2	UTSW	9	110632090	missense	possibly damaging	0.56
R5408:Nbeal2	UTSW	9	110637520	missense	possibly damaging	0.91
R5540:Nbeal2	UTSW	9	110631733	missense	probably damaging	1.00
R5866:Nbeal2	UTSW	9	110631492	missense	probably damaging	1.00
R5925:Nbeal2	UTSW	9	110629880	missense	probably benign	0.00
R6057:Nbeal2	UTSW	9	110641877	missense	possibly damaging	0.81
R6180:Nbeal2	UTSW	9	110625147	missense	probably damaging	1.00
R6191:Nbeal2	UTSW	9	110627990	critical splice donor site	probably null
R6232:Nbeal2	UTSW	9	110638734	missense	probably damaging	1.00
R6372:Nbeal2	UTSW	9	110628744	missense	possibly damaging	0.69
R6423:Nbeal2	UTSW	9	110625994	missense	probably damaging	1.00
R6543:Nbeal2	UTSW	9	110644458	missense	probably benign
R6648:Nbeal2	UTSW	9	110637642	missense	probably damaging	1.00
R6722:Nbeal2	UTSW	9	110632992	missense	probably damaging	1.00
R6738:Nbeal2	UTSW	9	110636905	missense	possibly damaging	0.93
R6916:Nbeal2	UTSW	9	110626108	missense	probably damaging	1.00
R6935:Nbeal2	UTSW	9	110639391	missense	probably damaging	1.00
R7022:Nbeal2	UTSW	9	110638618	missense	probably damaging	1.00
R7023:Nbeal2	UTSW	9	110638618	missense	probably damaging	1.00
R7050:Nbeal2	UTSW	9	110628720	missense	probably damaging	1.00
R7072:Nbeal2	UTSW	9	110626051	missense	probably benign	0.01
R7073:Nbeal2	UTSW	9	110626109	missense	probably damaging	0.99
R7099:Nbeal2	UTSW	9	110645438	splice site	probably null
R7354:Nbeal2	UTSW	9	110629179	missense	probably damaging	1.00
R7394:Nbeal2	UTSW	9	110630189	critical splice donor site	probably null
R7397:Nbeal2	UTSW	9	110628032	missense	possibly damaging	0.78
R7552:Nbeal2	UTSW	9	110653917	missense	probably benign	0.16
R7619:Nbeal2	UTSW	9	110625818	missense	probably benign	0.19
R7821:Nbeal2	UTSW	9	110630252	missense	probably damaging	1.00
R7902:Nbeal2	UTSW	9	110637547	missense	probably benign
R7923:Nbeal2	UTSW	9	110631446	nonsense	probably null
R8018:Nbeal2	UTSW	9	110629157	unclassified	probably benign
R8190:Nbeal2	UTSW	9	110626090	missense	probably benign	0.04
R8297:Nbeal2	UTSW	9	110635341	missense	possibly damaging	0.89
R8404:Nbeal2	UTSW	9	110634389	missense	possibly damaging	0.48
R8502:Nbeal2	UTSW	9	110634389	missense	possibly damaging	0.48
V7583:Nbeal2	UTSW	9	110637937	missense	possibly damaging	0.65
X0017:Nbeal2	UTSW	9	110644278	missense	probably benign	0.02
X0065:Nbeal2	UTSW	9	110644413	splice site	probably benign
Z1088:Nbeal2	UTSW	9	110632372	missense	possibly damaging	0.51
Z1176:Nbeal2	UTSW	9	110625816	missense	probably benign	0.01
Z1176:Nbeal2	UTSW	9	110638835	missense	probably benign
Z1177:Nbeal2	UTSW	9	110629854	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GCCGCTGCCATCTCTGAAATACAAC -3'
(R):5'- GTGAAACACACGACCTCGTAGGAC -3'

Sequencing Primer
(F):5'- TGAAATACAACCTCCAGGCAGG -3'
(R):5'- CAAGTCCTCAGGTGAGTGAC -3'

Posted On

2014-04-13