Incidental Mutation 'R1519:Nbeal2'
ID 167291
Institutional Source Beutler Lab
Gene Symbol Nbeal2
Ensembl Gene ENSMUSG00000056724
Gene Name neurobeachin-like 2
Synonyms 1110014F23Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.228) question?
Stock # R1519 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 110624789-110654161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110636305 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 955 (L955P)
Ref Sequence ENSEMBL: ENSMUSP00000143265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133191] [ENSMUST00000149089] [ENSMUST00000167320] [ENSMUST00000196488]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000123996
Predicted Effect unknown
Transcript: ENSMUST00000130024
AA Change: L454P
SMART Domains Protein: ENSMUSP00000118061
Gene: ENSMUSG00000056724
AA Change: L454P

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 236 248 N/A INTRINSIC
Pfam:DUF4704 345 607 2.5e-29 PFAM
low complexity region 649 664 N/A INTRINSIC
low complexity region 804 819 N/A INTRINSIC
Pfam:DUF4800 872 1138 9.9e-113 PFAM
low complexity region 1164 1193 N/A INTRINSIC
Pfam:PH_BEACH 1204 1291 2.2e-21 PFAM
Beach 1343 1623 5.2e-205 SMART
WD40 1721 1766 1.03e1 SMART
WD40 1769 1808 6.19e-5 SMART
WD40 1820 1859 1.02e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131017
SMART Domains Protein: ENSMUSP00000114660
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
Pfam:DUF4800 1 209 7.5e-97 PFAM
low complexity region 235 264 N/A INTRINSIC
Pfam:PH_BEACH 275 362 1e-21 PFAM
Beach 414 694 5.2e-205 SMART
WD40 762 807 1.03e1 SMART
WD40 810 849 6.19e-5 SMART
WD40 861 900 1.02e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133191
AA Change: L982P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724
AA Change: L982P

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
Pfam:Laminin_G_3 578 818 5.9e-8 PFAM
low complexity region 1014 1028 N/A INTRINSIC
low complexity region 1128 1136 N/A INTRINSIC
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1359 1375 N/A INTRINSIC
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1621 1647 N/A INTRINSIC
low complexity region 1875 1904 N/A INTRINSIC
Pfam:PH_BEACH 1908 2002 6.2e-28 PFAM
Beach 2054 2334 5.2e-205 SMART
WD40 2432 2477 1.03e1 SMART
WD40 2480 2519 6.19e-5 SMART
WD40 2531 2570 1.02e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138072
Predicted Effect probably benign
Transcript: ENSMUST00000149089
SMART Domains Protein: ENSMUSP00000119254
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
low complexity region 49 77 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
low complexity region 480 488 N/A INTRINSIC
low complexity region 493 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153960
Predicted Effect probably damaging
Transcript: ENSMUST00000167320
AA Change: L982P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724
AA Change: L982P

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 763 775 N/A INTRINSIC
Pfam:DUF4704 872 1148 9.2e-32 PFAM
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1366 1382 N/A INTRINSIC
low complexity region 1522 1537 N/A INTRINSIC
Pfam:DUF4800 1590 1856 1.5e-112 PFAM
low complexity region 1882 1911 N/A INTRINSIC
Pfam:PH_BEACH 1922 2009 3.1e-21 PFAM
Beach 2061 2341 5.2e-205 SMART
WD40 2439 2484 1.03e1 SMART
WD40 2487 2526 6.19e-5 SMART
WD40 2538 2577 1.02e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184024
Predicted Effect probably damaging
Transcript: ENSMUST00000196488
AA Change: L955P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724
AA Change: L955P

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 487 495 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
Pfam:Laminin_G_3 551 791 5.3e-6 PFAM
low complexity region 987 1001 N/A INTRINSIC
low complexity region 1101 1109 N/A INTRINSIC
low complexity region 1122 1136 N/A INTRINSIC
low complexity region 1332 1348 N/A INTRINSIC
low complexity region 1488 1503 N/A INTRINSIC
low complexity region 1594 1620 N/A INTRINSIC
low complexity region 1848 1877 N/A INTRINSIC
Pfam:PH_BEACH 1881 1975 3.1e-25 PFAM
Beach 2027 2307 3.8e-209 SMART
WD40 2405 2450 6.3e-2 SMART
WD40 2453 2492 3.8e-7 SMART
WD40 2504 2543 6.5e-8 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice exhibit megakaryocyte and platelet abnormalities resulting in impaired arterial thrombus formation and protection from infarction following cerebral ischemia. Wound repair is impaired. These abnormalities result in a bleeding disorder similiar to Gray Platelet Syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
9230019H11Rik A G 10: 3,125,230 noncoding transcript Het
9530077C05Rik T G 9: 22,430,375 L114R probably benign Het
Abhd5 T C 9: 122,379,014 probably null Het
Acadvl A G 11: 70,014,791 probably null Het
Actn1 T C 12: 80,205,078 E75G probably damaging Het
Adam4 A T 12: 81,420,877 N323K possibly damaging Het
Anks6 G A 4: 47,027,152 R689W probably damaging Het
Anxa2 T C 9: 69,485,241 I124T probably damaging Het
Aph1c T C 9: 66,833,265 T10A probably benign Het
Arhgap40 T A 2: 158,546,801 W552R probably benign Het
Baz2b C T 2: 59,948,254 R754H possibly damaging Het
Blmh A G 11: 76,966,781 Y147C probably damaging Het
C1galt1 C T 6: 7,866,402 L83F probably damaging Het
Cd163l1 G A 7: 140,228,156 V747I probably benign Het
Cdh23 A T 10: 60,379,343 Y1403N possibly damaging Het
Cic A T 7: 25,293,810 probably null Het
Coro1b T A 19: 4,150,584 V200D possibly damaging Het
Csl T A 10: 99,757,955 E416V probably damaging Het
Cyp3a25 A G 5: 146,001,447 probably null Het
Dennd2d T A 3: 106,492,559 F266Y probably damaging Het
Dnah10 A G 5: 124,760,952 E1072G probably damaging Het
Dnah6 T A 6: 73,049,048 K3435N probably damaging Het
Dnah9 G A 11: 65,881,761 A3715V probably damaging Het
Fam186a G A 15: 99,947,655 S236L unknown Het
Fam198b A G 3: 79,941,464 N506D possibly damaging Het
Frs3 A G 17: 47,702,978 T199A probably benign Het
Fsd1 A G 17: 55,993,870 N243S probably benign Het
Gabra5 A C 7: 57,408,893 L369R probably benign Het
Gins4 A G 8: 23,234,776 V54A probably benign Het
Gli1 T C 10: 127,334,269 E339G possibly damaging Het
Gm12185 A G 11: 48,907,767 V633A probably damaging Het
Gm8251 A G 1: 44,056,970 V1656A probably benign Het
Gm8765 G A 13: 50,700,407 probably null Het
Gpr83 T A 9: 14,868,197 C182S probably null Het
Gspt1 A G 16: 11,220,855 V627A probably damaging Het
Heatr1 T C 13: 12,412,159 C722R probably benign Het
Jak1 C T 4: 101,162,922 R680Q probably damaging Het
Kif2c A G 4: 117,169,940 V287A probably damaging Het
Kmo A G 1: 175,656,802 E366G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lepr A T 4: 101,789,344 N824I probably damaging Het
Lyrm7 T A 11: 54,848,599 H75L possibly damaging Het
Map4k1 A T 7: 28,991,036 Q351L probably benign Het
Mgam T C 6: 40,661,683 I450T probably benign Het
Nlrp9c T C 7: 26,378,101 K752R possibly damaging Het
Nsmaf A T 4: 6,438,062 I70K probably benign Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr298 A G 7: 86,489,125 M142T probably damaging Het
Otud7a A G 7: 63,758,643 Y898C probably damaging Het
Pcdhb18 A C 18: 37,490,892 D425A probably damaging Het
Prdm1 A T 10: 44,439,986 L733* probably null Het
Prdm2 A T 4: 143,135,583 I379N probably damaging Het
Ptprg A T 14: 12,220,596 Y436F probably damaging Het
Riok3 A G 18: 12,137,306 D167G probably damaging Het
Rnf215 G T 11: 4,135,451 R60L probably damaging Het
Sdk1 A T 5: 141,999,950 H779L probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sh3d21 T A 4: 126,151,726 K387* probably null Het
Slc13a2 T C 11: 78,397,746 Y568C possibly damaging Het
Slc27a5 T C 7: 12,988,459 probably null Het
Slc32a1 T C 2: 158,614,577 L384P probably damaging Het
Sorcs1 T C 19: 50,252,587 N454D probably benign Het
Spag8 T C 4: 43,652,777 Y228C possibly damaging Het
Spc25 T C 2: 69,200,087 I71V probably damaging Het
Tcte1 T A 17: 45,535,252 F261I probably damaging Het
Thsd7a T A 6: 12,471,175 K481N probably benign Het
Tll2 G T 19: 41,086,400 N908K probably benign Het
Tmem236 T C 2: 14,192,280 V93A probably benign Het
Top2b G A 14: 16,408,953 probably null Het
Topaz1 G A 9: 122,767,011 S949N probably benign Het
Triobp A G 15: 78,973,738 T1180A probably benign Het
Trip11 A C 12: 101,886,160 D548E probably benign Het
Trpv2 T A 11: 62,589,826 probably null Het
Vmn1r12 T A 6: 57,159,555 H212Q probably damaging Het
Vmn2r112 A G 17: 22,618,903 T782A possibly damaging Het
Vmn2r7 A G 3: 64,716,455 V239A possibly damaging Het
Vmn2r80 T A 10: 79,194,219 N626K probably damaging Het
Vmn2r99 A G 17: 19,380,060 S449G probably benign Het
Wfikkn2 T C 11: 94,238,107 T403A probably benign Het
Xirp2 A G 2: 67,515,679 I2755V probably benign Het
Yjefn3 A G 8: 69,889,079 V153A probably benign Het
Zfp677 C A 17: 21,397,237 H185Q possibly damaging Het
Zfp947 C T 17: 22,146,292 V134I probably benign Het
Other mutations in Nbeal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Nbeal2 APN 9 110635869 missense probably damaging 1.00
IGL00784:Nbeal2 APN 9 110629763 splice site probably benign
IGL00826:Nbeal2 APN 9 110626903 missense probably benign
IGL00885:Nbeal2 APN 9 110638661 missense probably damaging 1.00
IGL01348:Nbeal2 APN 9 110629146 missense probably damaging 0.99
IGL01511:Nbeal2 APN 9 110629234 missense probably damaging 1.00
IGL01571:Nbeal2 APN 9 110632758 missense possibly damaging 0.63
IGL01612:Nbeal2 APN 9 110644678 missense probably damaging 1.00
IGL01924:Nbeal2 APN 9 110631414 missense probably benign 0.23
IGL02056:Nbeal2 APN 9 110627324 missense probably benign 0.17
IGL02481:Nbeal2 APN 9 110625995 nonsense probably null
IGL02483:Nbeal2 APN 9 110625995 nonsense probably null
IGL02502:Nbeal2 APN 9 110633768 missense probably damaging 1.00
IGL02631:Nbeal2 APN 9 110630208 missense probably damaging 0.99
IGL02637:Nbeal2 APN 9 110625977 missense possibly damaging 0.62
IGL02727:Nbeal2 APN 9 110639285 splice site probably benign
IGL02887:Nbeal2 APN 9 110628276 missense probably damaging 1.00
IGL02896:Nbeal2 APN 9 110639292 critical splice donor site probably null
IGL03110:Nbeal2 APN 9 110631433 missense probably damaging 1.00
Antonym UTSW 9 110630252 missense probably damaging 1.00
Beowulf UTSW 9 110637937 missense possibly damaging 0.65
Blackmail UTSW 9 110629639 missense probably damaging 1.00
dog UTSW 9 110635341 missense possibly damaging 0.89
extortion UTSW 9 110630243 missense probably damaging 1.00
legion UTSW 9 110629179 missense probably damaging 1.00
litigious UTSW 9 110628195 missense probably damaging 1.00
mall UTSW 9 110632886 missense probably damaging 1.00
Mollusca UTSW 9 110645438 splice site probably null
Schleuter UTSW 9 110628744 missense possibly damaging 0.69
shellfish UTSW 9 110628720 missense probably damaging 1.00
Sophomoric UTSW 9 110633047 missense probably damaging 1.00
F5770:Nbeal2 UTSW 9 110637937 missense possibly damaging 0.65
R0032:Nbeal2 UTSW 9 110637868 splice site probably benign
R0084:Nbeal2 UTSW 9 110643710 critical splice donor site probably null
R0147:Nbeal2 UTSW 9 110642143 nonsense probably null
R0294:Nbeal2 UTSW 9 110632859 missense probably damaging 1.00
R0310:Nbeal2 UTSW 9 110638163 missense probably damaging 1.00
R0494:Nbeal2 UTSW 9 110627187 missense probably damaging 1.00
R0550:Nbeal2 UTSW 9 110642158 missense probably benign 0.01
R0630:Nbeal2 UTSW 9 110636034 splice site probably benign
R0762:Nbeal2 UTSW 9 110643808 splice site probably benign
R0862:Nbeal2 UTSW 9 110628195 missense probably damaging 1.00
R0864:Nbeal2 UTSW 9 110628195 missense probably damaging 1.00
R1225:Nbeal2 UTSW 9 110632886 missense probably damaging 1.00
R1240:Nbeal2 UTSW 9 110627108 missense probably damaging 0.98
R1450:Nbeal2 UTSW 9 110633672 splice site probably benign
R1655:Nbeal2 UTSW 9 110632872 missense probably damaging 1.00
R1668:Nbeal2 UTSW 9 110638893 missense probably damaging 1.00
R1705:Nbeal2 UTSW 9 110625196 missense probably damaging 1.00
R1784:Nbeal2 UTSW 9 110630857 nonsense probably null
R1834:Nbeal2 UTSW 9 110627129 missense probably damaging 1.00
R1997:Nbeal2 UTSW 9 110632198 missense probably damaging 1.00
R2013:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2014:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2055:Nbeal2 UTSW 9 110635307 missense possibly damaging 0.92
R2086:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2113:Nbeal2 UTSW 9 110625406 missense probably damaging 1.00
R2167:Nbeal2 UTSW 9 110638308 missense probably damaging 1.00
R2201:Nbeal2 UTSW 9 110630250 missense probably benign 0.16
R2309:Nbeal2 UTSW 9 110626570 missense probably damaging 1.00
R2378:Nbeal2 UTSW 9 110630808 missense probably damaging 0.99
R2945:Nbeal2 UTSW 9 110628068 missense possibly damaging 0.82
R3052:Nbeal2 UTSW 9 110633085 missense possibly damaging 0.93
R3076:Nbeal2 UTSW 9 110631700 missense probably damaging 1.00
R3176:Nbeal2 UTSW 9 110636887 splice site probably benign
R3974:Nbeal2 UTSW 9 110633846 missense probably damaging 1.00
R4183:Nbeal2 UTSW 9 110636675 missense probably benign
R4342:Nbeal2 UTSW 9 110631793 intron probably benign
R4654:Nbeal2 UTSW 9 110632004 missense probably damaging 1.00
R4707:Nbeal2 UTSW 9 110632055 missense probably benign 0.10
R4822:Nbeal2 UTSW 9 110636315 missense possibly damaging 0.82
R4854:Nbeal2 UTSW 9 110631396 missense probably damaging 1.00
R4860:Nbeal2 UTSW 9 110635194 missense probably benign 0.00
R4860:Nbeal2 UTSW 9 110635194 missense probably benign 0.00
R4990:Nbeal2 UTSW 9 110634803 missense probably benign 0.10
R4991:Nbeal2 UTSW 9 110638767 missense probably damaging 1.00
R5021:Nbeal2 UTSW 9 110637463 missense probably damaging 0.99
R5057:Nbeal2 UTSW 9 110631005 missense probably damaging 1.00
R5092:Nbeal2 UTSW 9 110626728 splice site probably null
R5161:Nbeal2 UTSW 9 110629868 missense probably benign
R5202:Nbeal2 UTSW 9 110644666 missense probably damaging 0.99
R5217:Nbeal2 UTSW 9 110632090 missense possibly damaging 0.56
R5408:Nbeal2 UTSW 9 110637520 missense possibly damaging 0.91
R5540:Nbeal2 UTSW 9 110631733 missense probably damaging 1.00
R5866:Nbeal2 UTSW 9 110631492 missense probably damaging 1.00
R5925:Nbeal2 UTSW 9 110629880 missense probably benign 0.00
R6057:Nbeal2 UTSW 9 110641877 missense possibly damaging 0.81
R6180:Nbeal2 UTSW 9 110625147 missense probably damaging 1.00
R6191:Nbeal2 UTSW 9 110627990 critical splice donor site probably null
R6232:Nbeal2 UTSW 9 110638734 missense probably damaging 1.00
R6372:Nbeal2 UTSW 9 110628744 missense possibly damaging 0.69
R6423:Nbeal2 UTSW 9 110625994 missense probably damaging 1.00
R6543:Nbeal2 UTSW 9 110644458 missense probably benign
R6648:Nbeal2 UTSW 9 110637642 missense probably damaging 1.00
R6722:Nbeal2 UTSW 9 110632992 missense probably damaging 1.00
R6738:Nbeal2 UTSW 9 110636905 missense possibly damaging 0.93
R6916:Nbeal2 UTSW 9 110626108 missense probably damaging 1.00
R6935:Nbeal2 UTSW 9 110639391 missense probably damaging 1.00
R7022:Nbeal2 UTSW 9 110638618 missense probably damaging 1.00
R7023:Nbeal2 UTSW 9 110638618 missense probably damaging 1.00
R7050:Nbeal2 UTSW 9 110628720 missense probably damaging 1.00
R7072:Nbeal2 UTSW 9 110626051 missense probably benign 0.01
R7073:Nbeal2 UTSW 9 110626109 missense probably damaging 0.99
R7099:Nbeal2 UTSW 9 110645438 splice site probably null
R7354:Nbeal2 UTSW 9 110629179 missense probably damaging 1.00
R7394:Nbeal2 UTSW 9 110630189 critical splice donor site probably null
R7397:Nbeal2 UTSW 9 110628032 missense possibly damaging 0.78
R7552:Nbeal2 UTSW 9 110653917 missense probably benign 0.16
R7619:Nbeal2 UTSW 9 110625818 missense probably benign 0.19
R7821:Nbeal2 UTSW 9 110630252 missense probably damaging 1.00
R7902:Nbeal2 UTSW 9 110637547 missense probably benign
R7923:Nbeal2 UTSW 9 110631446 nonsense probably null
R8018:Nbeal2 UTSW 9 110629157 unclassified probably benign
R8190:Nbeal2 UTSW 9 110626090 missense probably benign 0.04
R8297:Nbeal2 UTSW 9 110635341 missense possibly damaging 0.89
R8404:Nbeal2 UTSW 9 110634389 missense possibly damaging 0.48
R8502:Nbeal2 UTSW 9 110634389 missense possibly damaging 0.48
R8737:Nbeal2 UTSW 9 110627881 missense probably damaging 1.00
R8782:Nbeal2 UTSW 9 110630805 missense probably benign 0.04
R8807:Nbeal2 UTSW 9 110629639 missense probably damaging 1.00
R8877:Nbeal2 UTSW 9 110630243 missense probably damaging 1.00
R9057:Nbeal2 UTSW 9 110627150 missense probably benign
R9267:Nbeal2 UTSW 9 110633047 missense probably damaging 1.00
R9313:Nbeal2 UTSW 9 110634368 missense probably damaging 1.00
R9352:Nbeal2 UTSW 9 110627848 missense probably benign 0.03
R9482:Nbeal2 UTSW 9 110633998 missense probably benign 0.25
R9533:Nbeal2 UTSW 9 110644661 missense probably benign 0.01
R9566:Nbeal2 UTSW 9 110628921 missense probably benign 0.00
R9769:Nbeal2 UTSW 9 110626279 missense probably benign 0.01
V7583:Nbeal2 UTSW 9 110637937 missense possibly damaging 0.65
X0017:Nbeal2 UTSW 9 110644278 missense probably benign 0.02
X0065:Nbeal2 UTSW 9 110644413 splice site probably benign
Z1088:Nbeal2 UTSW 9 110632372 missense possibly damaging 0.51
Z1176:Nbeal2 UTSW 9 110625816 missense probably benign 0.01
Z1176:Nbeal2 UTSW 9 110638835 missense probably benign
Z1177:Nbeal2 UTSW 9 110629854 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCGCTGCCATCTCTGAAATACAAC -3'
(R):5'- GTGAAACACACGACCTCGTAGGAC -3'

Sequencing Primer
(F):5'- TGAAATACAACCTCCAGGCAGG -3'
(R):5'- CAAGTCCTCAGGTGAGTGAC -3'
Posted On 2014-04-13