Incidental Mutation 'R1519:Cdh23'
ID 167297
Institutional Source Beutler Lab
Gene Symbol Cdh23
Ensembl Gene ENSMUSG00000012819
Gene Name cadherin related 23 (otocadherin)
Synonyms bob, sals, USH1D, ahl, mdfw, nmf252, 4930542A03Rik, nmf112, nmf181
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.428) question?
Stock # R1519 (G1)
Quality Score 187
Status Not validated
Chromosome 10
Chromosomal Location 60138527-60532269 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60215122 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 1403 (Y1403N)
Ref Sequence ENSEMBL: ENSMUSP00000101104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000073242
AA Change: Y1404N

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: Y1404N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105461
AA Change: Y1405N

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: Y1405N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105462
AA Change: Y1407N

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: Y1407N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105463
AA Change: Y1405N

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: Y1405N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105464
AA Change: Y1403N

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: Y1403N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144462
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,439,390 (GRCm39) P187R probably damaging Het
Abhd5 T C 9: 122,208,079 (GRCm39) probably null Het
Acadvl A G 11: 69,905,617 (GRCm39) probably null Het
Actn1 T C 12: 80,251,852 (GRCm39) E75G probably damaging Het
Adam4 A T 12: 81,467,651 (GRCm39) N323K possibly damaging Het
Anks6 G A 4: 47,027,152 (GRCm39) R689W probably damaging Het
Anxa2 T C 9: 69,392,523 (GRCm39) I124T probably damaging Het
Aph1c T C 9: 66,740,547 (GRCm39) T10A probably benign Het
Arhgap40 T A 2: 158,388,721 (GRCm39) W552R probably benign Het
Baz2b C T 2: 59,778,598 (GRCm39) R754H possibly damaging Het
Blmh A G 11: 76,857,607 (GRCm39) Y147C probably damaging Het
C1galt1 C T 6: 7,866,402 (GRCm39) L83F probably damaging Het
Ccdc168 A G 1: 44,096,130 (GRCm39) V1656A probably benign Het
Cic A T 7: 24,993,235 (GRCm39) probably null Het
Coro1b T A 19: 4,200,583 (GRCm39) V200D possibly damaging Het
Csl T A 10: 99,593,817 (GRCm39) E416V probably damaging Het
Cyp3a25 A G 5: 145,938,257 (GRCm39) probably null Het
Dennd2d T A 3: 106,399,875 (GRCm39) F266Y probably damaging Het
Dnah10 A G 5: 124,838,016 (GRCm39) E1072G probably damaging Het
Dnah6 T A 6: 73,026,031 (GRCm39) K3435N probably damaging Het
Dnah9 G A 11: 65,772,587 (GRCm39) A3715V probably damaging Het
Fam186a G A 15: 99,845,536 (GRCm39) S236L unknown Het
Frs3 A G 17: 48,013,903 (GRCm39) T199A probably benign Het
Fsd1 A G 17: 56,300,870 (GRCm39) N243S probably benign Het
Gabra5 A C 7: 57,058,641 (GRCm39) L369R probably benign Het
Gask1b A G 3: 79,848,771 (GRCm39) N506D possibly damaging Het
Gins4 A G 8: 23,724,792 (GRCm39) V54A probably benign Het
Gli1 T C 10: 127,170,138 (GRCm39) E339G possibly damaging Het
Gm12185 A G 11: 48,798,594 (GRCm39) V633A probably damaging Het
Gpr83 T A 9: 14,779,493 (GRCm39) C182S probably null Het
Gspt1 A G 16: 11,038,719 (GRCm39) V627A probably damaging Het
Heatr1 T C 13: 12,427,040 (GRCm39) C722R probably benign Het
Jak1 C T 4: 101,020,119 (GRCm39) R680Q probably damaging Het
Kif2c A G 4: 117,027,137 (GRCm39) V287A probably damaging Het
Kmo C T 1: 175,479,184 (GRCm39) P240L possibly damaging Het
Kmo A G 1: 175,484,368 (GRCm39) E366G probably damaging Het
Lepr A T 4: 101,646,541 (GRCm39) N824I probably damaging Het
Lyrm7 T A 11: 54,739,425 (GRCm39) H75L possibly damaging Het
Map4k1 A T 7: 28,690,461 (GRCm39) Q351L probably benign Het
Matcap2 T G 9: 22,341,671 (GRCm39) L114R probably benign Het
Mgam T C 6: 40,638,617 (GRCm39) I450T probably benign Het
Nbeal2 A G 9: 110,465,373 (GRCm39) L955P probably damaging Het
Nlrp9c T C 7: 26,077,526 (GRCm39) K752R possibly damaging Het
Nsmaf A T 4: 6,438,062 (GRCm39) I70K probably benign Het
Or14a257 A G 7: 86,138,333 (GRCm39) M142T probably damaging Het
Or5ac19 C T 16: 59,089,307 (GRCm39) C241Y probably damaging Het
Otud7a A G 7: 63,408,391 (GRCm39) Y898C probably damaging Het
Pcdhb18 A C 18: 37,623,945 (GRCm39) D425A probably damaging Het
Prdm1 A T 10: 44,315,982 (GRCm39) L733* probably null Het
Prdm2 A T 4: 142,862,153 (GRCm39) I379N probably damaging Het
Ptprg A T 14: 12,220,596 (GRCm38) Y436F probably damaging Het
Riok3 A G 18: 12,270,363 (GRCm39) D167G probably damaging Het
Rnf215 G T 11: 4,085,451 (GRCm39) R60L probably damaging Het
Scart1 G A 7: 139,808,069 (GRCm39) V747I probably benign Het
Sdk1 A T 5: 141,985,705 (GRCm39) H779L probably benign Het
Serpine2 A G 1: 79,772,748 (GRCm39) F390L probably damaging Het
Sh3d21 T A 4: 126,045,519 (GRCm39) K387* probably null Het
Slc13a2 T C 11: 78,288,572 (GRCm39) Y568C possibly damaging Het
Slc27a5 T C 7: 12,722,386 (GRCm39) probably null Het
Slc32a1 T C 2: 158,456,497 (GRCm39) L384P probably damaging Het
Sorcs1 T C 19: 50,241,025 (GRCm39) N454D probably benign Het
Spag8 T C 4: 43,652,777 (GRCm39) Y228C possibly damaging Het
Spata31e4 G A 13: 50,854,443 (GRCm39) probably null Het
Spc25 T C 2: 69,030,431 (GRCm39) I71V probably damaging Het
Tcte1 T A 17: 45,846,178 (GRCm39) F261I probably damaging Het
Thsd7a T A 6: 12,471,174 (GRCm39) K481N probably benign Het
Tll2 G T 19: 41,074,839 (GRCm39) N908K probably benign Het
Tmem236 T C 2: 14,197,091 (GRCm39) V93A probably benign Het
Top2b G A 14: 16,408,953 (GRCm38) probably null Het
Topaz1 G A 9: 122,596,076 (GRCm39) S949N probably benign Het
Triobp A G 15: 78,857,938 (GRCm39) T1180A probably benign Het
Trip11 A C 12: 101,852,419 (GRCm39) D548E probably benign Het
Trpv2 T A 11: 62,480,652 (GRCm39) probably null Het
Ulbp3 A G 10: 3,075,230 (GRCm39) noncoding transcript Het
Vmn1r12 T A 6: 57,136,540 (GRCm39) H212Q probably damaging Het
Vmn2r112 A G 17: 22,837,884 (GRCm39) T782A possibly damaging Het
Vmn2r7 A G 3: 64,623,876 (GRCm39) V239A possibly damaging Het
Vmn2r80 T A 10: 79,030,053 (GRCm39) N626K probably damaging Het
Vmn2r99 A G 17: 19,600,322 (GRCm39) S449G probably benign Het
Wfikkn2 T C 11: 94,128,933 (GRCm39) T403A probably benign Het
Xirp2 A G 2: 67,346,023 (GRCm39) I2755V probably benign Het
Yjefn3 A G 8: 70,341,729 (GRCm39) V153A probably benign Het
Zfp677 C A 17: 21,617,499 (GRCm39) H185Q possibly damaging Het
Zfp947 C T 17: 22,365,273 (GRCm39) V134I probably benign Het
Other mutations in Cdh23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Cdh23 APN 10 60,359,327 (GRCm39) missense probably benign 0.03
IGL00429:Cdh23 APN 10 60,256,920 (GRCm39) missense probably damaging 0.97
IGL01014:Cdh23 APN 10 60,143,301 (GRCm39) missense probably damaging 0.99
IGL01284:Cdh23 APN 10 60,301,876 (GRCm39) missense possibly damaging 0.95
IGL01305:Cdh23 APN 10 60,148,403 (GRCm39) missense probably damaging 1.00
IGL01367:Cdh23 APN 10 60,146,566 (GRCm39) missense probably damaging 1.00
IGL01396:Cdh23 APN 10 60,220,848 (GRCm39) missense possibly damaging 0.93
IGL01412:Cdh23 APN 10 60,150,473 (GRCm39) missense probably damaging 1.00
IGL01461:Cdh23 APN 10 60,244,926 (GRCm39) missense possibly damaging 0.53
IGL01469:Cdh23 APN 10 60,433,504 (GRCm39) missense probably benign 0.03
IGL01695:Cdh23 APN 10 60,167,612 (GRCm39) missense probably benign 0.20
IGL01734:Cdh23 APN 10 60,139,292 (GRCm39) missense probably benign
IGL01767:Cdh23 APN 10 60,151,503 (GRCm39) missense probably damaging 1.00
IGL01796:Cdh23 APN 10 60,146,916 (GRCm39) missense probably benign 0.31
IGL01843:Cdh23 APN 10 60,255,598 (GRCm39) splice site probably null
IGL02025:Cdh23 APN 10 60,220,922 (GRCm39) missense probably damaging 1.00
IGL02071:Cdh23 APN 10 60,359,339 (GRCm39) missense possibly damaging 0.93
IGL02160:Cdh23 APN 10 60,433,544 (GRCm39) splice site probably benign
IGL02175:Cdh23 APN 10 60,167,087 (GRCm39) missense possibly damaging 0.92
IGL02220:Cdh23 APN 10 60,140,903 (GRCm39) missense probably damaging 1.00
IGL02302:Cdh23 APN 10 60,159,302 (GRCm39) missense possibly damaging 0.87
IGL02331:Cdh23 APN 10 60,301,322 (GRCm39) missense probably damaging 0.99
IGL02452:Cdh23 APN 10 60,153,721 (GRCm39) missense probably damaging 0.99
IGL02499:Cdh23 APN 10 60,220,958 (GRCm39) missense probably damaging 1.00
IGL02548:Cdh23 APN 10 60,485,901 (GRCm39) missense probably benign 0.37
IGL02593:Cdh23 APN 10 60,301,774 (GRCm39) splice site probably benign
IGL02626:Cdh23 APN 10 60,227,580 (GRCm39) missense probably damaging 1.00
IGL02951:Cdh23 APN 10 60,147,143 (GRCm39) missense probably damaging 1.00
IGL03145:Cdh23 APN 10 60,212,593 (GRCm39) missense probably damaging 0.99
dee_dee UTSW 10 60,143,835 (GRCm39) nonsense probably null
hersey UTSW 10 60,143,815 (GRCm39) missense probably damaging 1.00
ANU22:Cdh23 UTSW 10 60,148,403 (GRCm39) missense probably damaging 1.00
IGL02980:Cdh23 UTSW 10 60,150,399 (GRCm39) missense probably damaging 1.00
PIT4362001:Cdh23 UTSW 10 60,301,237 (GRCm39) missense probably benign 0.15
R0013:Cdh23 UTSW 10 60,248,952 (GRCm39) missense possibly damaging 0.90
R0045:Cdh23 UTSW 10 60,366,757 (GRCm39) missense probably damaging 1.00
R0045:Cdh23 UTSW 10 60,366,757 (GRCm39) missense probably damaging 1.00
R0082:Cdh23 UTSW 10 60,148,366 (GRCm39) missense probably damaging 1.00
R0124:Cdh23 UTSW 10 60,143,835 (GRCm39) nonsense probably null
R0172:Cdh23 UTSW 10 60,155,411 (GRCm39) missense probably damaging 1.00
R0195:Cdh23 UTSW 10 60,152,838 (GRCm39) missense probably damaging 0.99
R0365:Cdh23 UTSW 10 60,215,094 (GRCm39) missense probably damaging 0.99
R0437:Cdh23 UTSW 10 60,246,576 (GRCm39) missense probably damaging 1.00
R0486:Cdh23 UTSW 10 60,222,725 (GRCm39) missense probably damaging 1.00
R0494:Cdh23 UTSW 10 60,152,375 (GRCm39) splice site probably benign
R0545:Cdh23 UTSW 10 60,167,070 (GRCm39) missense probably benign 0.06
R0619:Cdh23 UTSW 10 60,269,556 (GRCm39) missense probably damaging 1.00
R0647:Cdh23 UTSW 10 60,159,153 (GRCm39) nonsense probably null
R0647:Cdh23 UTSW 10 60,143,681 (GRCm39) missense probably damaging 0.99
R0730:Cdh23 UTSW 10 60,159,493 (GRCm39) missense probably damaging 0.99
R0880:Cdh23 UTSW 10 60,242,200 (GRCm39) missense possibly damaging 0.51
R0942:Cdh23 UTSW 10 60,246,639 (GRCm39) missense possibly damaging 0.67
R0989:Cdh23 UTSW 10 60,370,289 (GRCm39) missense probably damaging 0.99
R1017:Cdh23 UTSW 10 60,167,572 (GRCm39) missense probably damaging 1.00
R1173:Cdh23 UTSW 10 60,148,171 (GRCm39) splice site probably benign
R1449:Cdh23 UTSW 10 60,212,730 (GRCm39) missense probably damaging 1.00
R1456:Cdh23 UTSW 10 60,322,899 (GRCm39) missense possibly damaging 0.84
R1532:Cdh23 UTSW 10 60,150,110 (GRCm39) missense probably damaging 0.99
R1559:Cdh23 UTSW 10 60,255,478 (GRCm39) splice site probably benign
R1704:Cdh23 UTSW 10 60,150,390 (GRCm39) missense probably damaging 1.00
R1711:Cdh23 UTSW 10 60,359,315 (GRCm39) missense probably benign 0.07
R1760:Cdh23 UTSW 10 60,161,855 (GRCm39) missense probably damaging 1.00
R1782:Cdh23 UTSW 10 60,324,321 (GRCm39) missense probably damaging 1.00
R1791:Cdh23 UTSW 10 60,227,505 (GRCm39) missense possibly damaging 0.89
R1803:Cdh23 UTSW 10 60,167,060 (GRCm39) missense probably damaging 1.00
R1857:Cdh23 UTSW 10 60,159,076 (GRCm39) missense probably damaging 1.00
R1874:Cdh23 UTSW 10 60,272,597 (GRCm39) missense possibly damaging 0.52
R1914:Cdh23 UTSW 10 60,159,349 (GRCm39) missense probably damaging 0.99
R1958:Cdh23 UTSW 10 60,246,652 (GRCm39) missense probably benign 0.02
R1964:Cdh23 UTSW 10 60,221,001 (GRCm39) missense probably benign 0.31
R1966:Cdh23 UTSW 10 60,159,361 (GRCm39) missense probably damaging 1.00
R1981:Cdh23 UTSW 10 60,214,530 (GRCm39) missense probably damaging 1.00
R2010:Cdh23 UTSW 10 60,150,006 (GRCm39) missense probably damaging 0.99
R2036:Cdh23 UTSW 10 60,301,822 (GRCm39) missense possibly damaging 0.52
R2038:Cdh23 UTSW 10 60,148,366 (GRCm39) missense probably damaging 1.00
R2044:Cdh23 UTSW 10 60,432,509 (GRCm39) missense possibly damaging 0.72
R2111:Cdh23 UTSW 10 60,141,362 (GRCm39) missense probably damaging 0.99
R2112:Cdh23 UTSW 10 60,141,362 (GRCm39) missense probably damaging 0.99
R2211:Cdh23 UTSW 10 60,301,783 (GRCm39) missense possibly damaging 0.92
R2261:Cdh23 UTSW 10 60,152,907 (GRCm39) missense probably damaging 1.00
R2262:Cdh23 UTSW 10 60,152,907 (GRCm39) missense probably damaging 1.00
R2306:Cdh23 UTSW 10 60,159,224 (GRCm39) missense probably damaging 1.00
R2344:Cdh23 UTSW 10 60,152,503 (GRCm39) missense probably damaging 1.00
R2857:Cdh23 UTSW 10 60,218,432 (GRCm39) critical splice donor site probably null
R2858:Cdh23 UTSW 10 60,218,432 (GRCm39) critical splice donor site probably null
R2859:Cdh23 UTSW 10 60,218,432 (GRCm39) critical splice donor site probably null
R2876:Cdh23 UTSW 10 60,143,275 (GRCm39) missense probably damaging 1.00
R3034:Cdh23 UTSW 10 60,244,789 (GRCm39) splice site probably benign
R3424:Cdh23 UTSW 10 60,212,660 (GRCm39) missense possibly damaging 0.76
R3699:Cdh23 UTSW 10 60,163,149 (GRCm39) critical splice donor site probably null
R3700:Cdh23 UTSW 10 60,163,149 (GRCm39) critical splice donor site probably null
R3950:Cdh23 UTSW 10 60,493,105 (GRCm39) missense probably benign 0.04
R3951:Cdh23 UTSW 10 60,493,105 (GRCm39) missense probably benign 0.04
R3952:Cdh23 UTSW 10 60,493,105 (GRCm39) missense probably benign 0.04
R4108:Cdh23 UTSW 10 60,246,601 (GRCm39) missense possibly damaging 0.51
R4114:Cdh23 UTSW 10 60,256,819 (GRCm39) splice site probably null
R4273:Cdh23 UTSW 10 60,146,940 (GRCm39) missense possibly damaging 0.69
R4284:Cdh23 UTSW 10 60,139,272 (GRCm39) missense possibly damaging 0.91
R4334:Cdh23 UTSW 10 60,220,838 (GRCm39) missense probably damaging 0.99
R4474:Cdh23 UTSW 10 60,146,865 (GRCm39) missense probably damaging 1.00
R4532:Cdh23 UTSW 10 60,370,202 (GRCm39) missense probably benign 0.32
R4597:Cdh23 UTSW 10 60,244,823 (GRCm39) missense probably damaging 1.00
R4604:Cdh23 UTSW 10 60,173,445 (GRCm39) missense possibly damaging 0.93
R4793:Cdh23 UTSW 10 60,167,129 (GRCm39) missense probably damaging 1.00
R4816:Cdh23 UTSW 10 60,244,856 (GRCm39) missense possibly damaging 0.93
R4833:Cdh23 UTSW 10 60,220,817 (GRCm39) missense probably damaging 1.00
R4840:Cdh23 UTSW 10 60,255,556 (GRCm39) missense possibly damaging 0.53
R4857:Cdh23 UTSW 10 60,227,563 (GRCm39) missense probably damaging 1.00
R4869:Cdh23 UTSW 10 60,212,713 (GRCm39) missense probably damaging 1.00
R4894:Cdh23 UTSW 10 60,173,630 (GRCm39) missense probably benign 0.04
R4940:Cdh23 UTSW 10 60,143,714 (GRCm39) missense probably damaging 0.98
R5020:Cdh23 UTSW 10 60,143,811 (GRCm39) missense probably damaging 0.99
R5026:Cdh23 UTSW 10 60,140,627 (GRCm39) missense possibly damaging 0.88
R5081:Cdh23 UTSW 10 60,272,586 (GRCm39) missense possibly damaging 0.89
R5138:Cdh23 UTSW 10 60,148,061 (GRCm39) missense probably damaging 1.00
R5236:Cdh23 UTSW 10 60,148,351 (GRCm39) missense probably damaging 1.00
R5361:Cdh23 UTSW 10 60,493,044 (GRCm39) critical splice donor site probably null
R5384:Cdh23 UTSW 10 60,173,541 (GRCm39) missense probably damaging 0.99
R5500:Cdh23 UTSW 10 60,150,090 (GRCm39) missense probably damaging 1.00
R5512:Cdh23 UTSW 10 60,370,165 (GRCm39) splice site probably null
R5673:Cdh23 UTSW 10 60,143,636 (GRCm39) missense probably damaging 1.00
R5720:Cdh23 UTSW 10 60,228,802 (GRCm39) missense possibly damaging 0.71
R5726:Cdh23 UTSW 10 60,243,259 (GRCm39) missense probably damaging 0.98
R5732:Cdh23 UTSW 10 60,167,096 (GRCm39) missense possibly damaging 0.80
R5739:Cdh23 UTSW 10 60,141,388 (GRCm39) missense probably damaging 0.99
R5760:Cdh23 UTSW 10 60,242,171 (GRCm39) missense probably damaging 0.99
R5793:Cdh23 UTSW 10 60,141,907 (GRCm39) missense probably damaging 1.00
R5880:Cdh23 UTSW 10 60,220,713 (GRCm39) missense probably damaging 1.00
R5905:Cdh23 UTSW 10 60,370,314 (GRCm39) missense probably damaging 0.98
R5907:Cdh23 UTSW 10 60,264,158 (GRCm39) missense probably damaging 1.00
R5910:Cdh23 UTSW 10 60,213,600 (GRCm39) missense possibly damaging 0.81
R5932:Cdh23 UTSW 10 60,228,763 (GRCm39) missense probably damaging 1.00
R5996:Cdh23 UTSW 10 60,249,356 (GRCm39) missense possibly damaging 0.85
R6015:Cdh23 UTSW 10 60,143,761 (GRCm39) missense probably damaging 0.97
R6020:Cdh23 UTSW 10 60,167,105 (GRCm39) missense probably damaging 1.00
R6023:Cdh23 UTSW 10 60,301,321 (GRCm39) missense probably damaging 1.00
R6028:Cdh23 UTSW 10 60,370,314 (GRCm39) missense probably damaging 0.98
R6066:Cdh23 UTSW 10 60,269,537 (GRCm39) missense probably damaging 1.00
R6137:Cdh23 UTSW 10 60,270,291 (GRCm39) missense probably damaging 0.96
R6211:Cdh23 UTSW 10 60,246,600 (GRCm39) missense possibly damaging 0.90
R6298:Cdh23 UTSW 10 60,262,451 (GRCm39) nonsense probably null
R6302:Cdh23 UTSW 10 60,140,872 (GRCm39) missense possibly damaging 0.74
R6338:Cdh23 UTSW 10 60,248,930 (GRCm39) missense probably damaging 1.00
R6356:Cdh23 UTSW 10 60,274,626 (GRCm39) missense probably damaging 1.00
R6441:Cdh23 UTSW 10 60,143,815 (GRCm39) missense probably damaging 1.00
R6714:Cdh23 UTSW 10 60,167,609 (GRCm39) missense possibly damaging 0.62
R6760:Cdh23 UTSW 10 60,141,947 (GRCm39) missense probably damaging 1.00
R6807:Cdh23 UTSW 10 60,214,650 (GRCm39) missense possibly damaging 0.95
R6855:Cdh23 UTSW 10 60,141,901 (GRCm39) missense possibly damaging 0.66
R6937:Cdh23 UTSW 10 60,322,893 (GRCm39) missense probably damaging 1.00
R6942:Cdh23 UTSW 10 60,274,635 (GRCm39) missense possibly damaging 0.93
R6961:Cdh23 UTSW 10 60,485,893 (GRCm39) missense probably benign 0.00
R7009:Cdh23 UTSW 10 60,173,085 (GRCm39) missense probably damaging 0.99
R7010:Cdh23 UTSW 10 60,366,770 (GRCm39) missense probably benign 0.03
R7032:Cdh23 UTSW 10 60,167,567 (GRCm39) missense probably damaging 1.00
R7046:Cdh23 UTSW 10 60,214,530 (GRCm39) missense probably damaging 1.00
R7111:Cdh23 UTSW 10 60,222,823 (GRCm39) missense probably damaging 1.00
R7196:Cdh23 UTSW 10 60,143,759 (GRCm39) missense probably damaging 0.99
R7198:Cdh23 UTSW 10 60,148,378 (GRCm39) missense possibly damaging 0.91
R7223:Cdh23 UTSW 10 60,167,596 (GRCm39) missense probably damaging 1.00
R7290:Cdh23 UTSW 10 60,212,620 (GRCm39) missense probably benign
R7335:Cdh23 UTSW 10 60,140,895 (GRCm39) missense probably damaging 1.00
R7340:Cdh23 UTSW 10 60,366,775 (GRCm39) missense probably benign 0.19
R7350:Cdh23 UTSW 10 60,246,689 (GRCm39) missense probably damaging 1.00
R7366:Cdh23 UTSW 10 60,151,471 (GRCm39) nonsense probably null
R7374:Cdh23 UTSW 10 60,153,679 (GRCm39) missense probably damaging 0.99
R7455:Cdh23 UTSW 10 60,142,003 (GRCm39) missense possibly damaging 0.82
R7537:Cdh23 UTSW 10 60,220,724 (GRCm39) missense probably benign 0.17
R7573:Cdh23 UTSW 10 60,159,329 (GRCm39) missense probably benign 0.17
R7578:Cdh23 UTSW 10 60,243,186 (GRCm39) missense probably benign 0.14
R7646:Cdh23 UTSW 10 60,140,931 (GRCm39) missense possibly damaging 0.95
R7703:Cdh23 UTSW 10 60,173,043 (GRCm39) missense probably damaging 1.00
R7763:Cdh23 UTSW 10 60,148,356 (GRCm39) missense probably damaging 1.00
R7797:Cdh23 UTSW 10 60,220,973 (GRCm39) missense probably benign 0.07
R7867:Cdh23 UTSW 10 60,150,390 (GRCm39) missense probably damaging 1.00
R7878:Cdh23 UTSW 10 60,149,979 (GRCm39) missense possibly damaging 0.69
R7915:Cdh23 UTSW 10 60,143,668 (GRCm39) missense probably damaging 0.97
R7922:Cdh23 UTSW 10 60,218,485 (GRCm39) missense probably benign 0.31
R7963:Cdh23 UTSW 10 60,171,967 (GRCm39) missense probably damaging 1.00
R7997:Cdh23 UTSW 10 60,432,518 (GRCm39) missense possibly damaging 0.81
R8167:Cdh23 UTSW 10 60,150,162 (GRCm39) missense probably benign 0.12
R8167:Cdh23 UTSW 10 60,173,472 (GRCm39) missense probably damaging 0.96
R8258:Cdh23 UTSW 10 60,151,435 (GRCm39) missense probably damaging 0.99
R8259:Cdh23 UTSW 10 60,151,435 (GRCm39) missense probably damaging 0.99
R8317:Cdh23 UTSW 10 60,272,568 (GRCm39) missense probably damaging 1.00
R8317:Cdh23 UTSW 10 60,147,037 (GRCm39) critical splice donor site probably null
R8326:Cdh23 UTSW 10 60,274,591 (GRCm39) missense possibly damaging 0.55
R8333:Cdh23 UTSW 10 60,150,390 (GRCm39) missense probably damaging 1.00
R8348:Cdh23 UTSW 10 60,167,507 (GRCm39) missense probably benign 0.43
R8366:Cdh23 UTSW 10 60,160,799 (GRCm39) missense probably benign
R8504:Cdh23 UTSW 10 60,274,618 (GRCm39) missense probably benign 0.00
R8676:Cdh23 UTSW 10 60,246,689 (GRCm39) missense probably damaging 1.00
R8781:Cdh23 UTSW 10 60,167,567 (GRCm39) missense probably damaging 1.00
R8785:Cdh23 UTSW 10 60,147,114 (GRCm39) missense probably damaging 1.00
R8788:Cdh23 UTSW 10 60,324,372 (GRCm39) missense probably damaging 1.00
R8802:Cdh23 UTSW 10 60,244,877 (GRCm39) missense probably benign 0.04
R8837:Cdh23 UTSW 10 60,160,755 (GRCm39) missense probably benign 0.28
R8863:Cdh23 UTSW 10 60,212,613 (GRCm39) nonsense probably null
R8889:Cdh23 UTSW 10 60,143,284 (GRCm39) missense probably damaging 0.97
R8892:Cdh23 UTSW 10 60,143,284 (GRCm39) missense probably damaging 0.97
R8921:Cdh23 UTSW 10 60,140,908 (GRCm39) missense probably damaging 0.99
R8980:Cdh23 UTSW 10 60,173,625 (GRCm39) missense probably benign 0.06
R9000:Cdh23 UTSW 10 60,140,277 (GRCm39) missense possibly damaging 0.82
R9043:Cdh23 UTSW 10 60,151,478 (GRCm39) missense probably benign 0.00
R9046:Cdh23 UTSW 10 60,218,303 (GRCm39) intron probably benign
R9070:Cdh23 UTSW 10 60,173,539 (GRCm39) missense probably benign
R9075:Cdh23 UTSW 10 60,153,541 (GRCm39) missense probably damaging 1.00
R9132:Cdh23 UTSW 10 60,270,283 (GRCm39) splice site probably benign
R9155:Cdh23 UTSW 10 60,249,485 (GRCm39) missense probably damaging 0.99
R9171:Cdh23 UTSW 10 60,161,810 (GRCm39) missense probably benign 0.00
R9179:Cdh23 UTSW 10 60,153,664 (GRCm39) missense probably benign 0.06
R9186:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9189:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9207:Cdh23 UTSW 10 60,243,210 (GRCm39) missense probably damaging 1.00
R9240:Cdh23 UTSW 10 60,215,044 (GRCm39) missense probably benign 0.00
R9244:Cdh23 UTSW 10 60,249,442 (GRCm39) missense possibly damaging 0.93
R9284:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9286:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9287:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9302:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9352:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9353:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9423:Cdh23 UTSW 10 60,148,387 (GRCm39) missense probably damaging 1.00
R9513:Cdh23 UTSW 10 60,166,995 (GRCm39) missense probably damaging 0.99
R9577:Cdh23 UTSW 10 60,146,895 (GRCm39) missense probably damaging 1.00
R9598:Cdh23 UTSW 10 60,214,574 (GRCm39) missense probably benign 0.01
R9631:Cdh23 UTSW 10 60,243,168 (GRCm39) missense possibly damaging 0.49
R9652:Cdh23 UTSW 10 60,167,135 (GRCm39) missense probably damaging 1.00
R9725:Cdh23 UTSW 10 60,432,561 (GRCm39) missense probably benign 0.02
X0052:Cdh23 UTSW 10 60,220,913 (GRCm39) missense probably damaging 1.00
Z1088:Cdh23 UTSW 10 60,249,423 (GRCm39) missense probably benign 0.35
Z1176:Cdh23 UTSW 10 60,264,100 (GRCm39) missense probably benign
Z1176:Cdh23 UTSW 10 60,146,549 (GRCm39) missense probably damaging 1.00
Z1177:Cdh23 UTSW 10 60,270,393 (GRCm39) critical splice acceptor site probably null
Z1177:Cdh23 UTSW 10 60,159,334 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CGCTTGCTAACACAAAGCTTGCTG -3'
(R):5'- CTTCATTCCCATGAGCTGGAACCC -3'

Sequencing Primer
(F):5'- AAAGCTTGCTGGCTCAGAC -3'
(R):5'- cacacacacacacgcac -3'
Posted On 2014-04-13