Mutagenetix > Incidental Mutation

Incidental Mutation 'R1519:Cdh23'

167297

Institutional Source

Beutler Lab

Gene Symbol

Cdh23

Ensembl Gene

ENSMUSG00000012819

Gene Name

cadherin 23 (otocadherin)

Synonyms

nmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.595) question?

Stock #

R1519 (G1)

Quality Score

187

Status

Not validated

Chromosome

Chromosomal Location

60302748-60696490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 60379343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1403 (Y1403N)

Ref Sequence

ENSEMBL: ENSMUSP00000101104 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073242
AA Change: Y1404N

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: Y1404N

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	8.11e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1415	1.21e-18	SMART
CA	1440	1524	2.38e-26	SMART
CA	1549	1631	6.27e-26	SMART
CA	1656	1741	6.99e-24	SMART
CA	1765	1848	3.49e-24	SMART
CA	1872	1956	2.78e-18	SMART
CA	1984	2066	5.6e-14	SMART
CA	2090	2171	2.59e-27	SMART
CA	2195	2290	2.87e-11	SMART
CA	2317	2399	1.01e-20	SMART
CA	2423	2506	1.09e-25	SMART
CA	2530	2608	7.91e-23	SMART
CA	2634	2719	1.06e-23	SMART
CA	2750	2843	2e-10	SMART
Blast:CA	2867	2956	4e-51	BLAST
transmembrane domain	3067	3089	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105461
AA Change: Y1405N

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: Y1405N

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105462
AA Change: Y1407N

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: Y1407N

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	261	349	2.03e-11	SMART
CA	374	461	8.11e-11	SMART
CA	485	562	1.04e-22	SMART
CA	586	672	3.55e-25	SMART
CA	696	779	2.04e-25	SMART
CA	803	891	5.03e-16	SMART
CA	915	996	1.05e-27	SMART
CA	1020	1103	1.99e-19	SMART
CA	1127	1209	6.94e-19	SMART
CA	1234	1314	1.99e-19	SMART
CA	1338	1418	1.21e-18	SMART
CA	1443	1527	2.38e-26	SMART
CA	1552	1634	6.27e-26	SMART
CA	1659	1744	6.99e-24	SMART
CA	1768	1851	3.49e-24	SMART
CA	1875	1959	2.78e-18	SMART
CA	1987	2069	5.6e-14	SMART
CA	2093	2174	2.59e-27	SMART
CA	2198	2293	2.87e-11	SMART
CA	2320	2402	1.01e-20	SMART
CA	2426	2509	1.09e-25	SMART
CA	2533	2611	7.91e-23	SMART
CA	2637	2722	1.06e-23	SMART
CA	2753	2846	2e-10	SMART
Blast:CA	2870	2959	4e-51	BLAST
transmembrane domain	3070	3092	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105463
AA Change: Y1405N

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: Y1405N

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105464
AA Change: Y1403N

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: Y1403N

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	456	3.58e-12	SMART
CA	480	557	1.04e-22	SMART
CA	581	667	3.55e-25	SMART
CA	691	774	2.04e-25	SMART
CA	798	886	5.03e-16	SMART
CA	910	991	1.05e-27	SMART
CA	1015	1098	1.99e-19	SMART
CA	1122	1204	6.94e-19	SMART
CA	1229	1309	1.99e-19	SMART
CA	1333	1414	5.26e-19	SMART
CA	1439	1523	2.38e-26	SMART
CA	1548	1630	6.27e-26	SMART
CA	1655	1740	6.99e-24	SMART
CA	1764	1847	3.49e-24	SMART
CA	1871	1955	2.78e-18	SMART
CA	1983	2065	5.6e-14	SMART
CA	2089	2170	2.59e-27	SMART
CA	2194	2289	2.87e-11	SMART
CA	2316	2398	1.01e-20	SMART
CA	2422	2505	1.09e-25	SMART
CA	2529	2607	7.91e-23	SMART
CA	2633	2718	1.06e-23	SMART
CA	2749	2842	2e-10	SMART
Blast:CA	2866	2955	3e-51	BLAST
transmembrane domain	3066	3088	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124712

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127312

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128249

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135638

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144462

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	C	G	10: 100,603,528	P187R	probably damaging	Het
9230019H11Rik	A	G	10: 3,125,230		noncoding transcript	Het
9530077C05Rik	T	G	9: 22,430,375	L114R	probably benign	Het
Abhd5	T	C	9: 122,379,014		probably null	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Actn1	T	C	12: 80,205,078	E75G	probably damaging	Het
Adam4	A	T	12: 81,420,877	N323K	possibly damaging	Het
Anks6	G	A	4: 47,027,152	R689W	probably damaging	Het
Anxa2	T	C	9: 69,485,241	I124T	probably damaging	Het
Aph1c	T	C	9: 66,833,265	T10A	probably benign	Het
Arhgap40	T	A	2: 158,546,801	W552R	probably benign	Het
Baz2b	C	T	2: 59,948,254	R754H	possibly damaging	Het
Blmh	A	G	11: 76,966,781	Y147C	probably damaging	Het
C1galt1	C	T	6: 7,866,402	L83F	probably damaging	Het
Cd163l1	G	A	7: 140,228,156	V747I	probably benign	Het
Cic	A	T	7: 25,293,810		probably null	Het
Coro1b	T	A	19: 4,150,584	V200D	possibly damaging	Het
Csl	T	A	10: 99,757,955	E416V	probably damaging	Het
Cyp3a25	A	G	5: 146,001,447		probably null	Het
Dennd2d	T	A	3: 106,492,559	F266Y	probably damaging	Het
Dnah10	A	G	5: 124,760,952	E1072G	probably damaging	Het
Dnah6	T	A	6: 73,049,048	K3435N	probably damaging	Het
Dnah9	G	A	11: 65,881,761	A3715V	probably damaging	Het
Fam186a	G	A	15: 99,947,655	S236L	unknown	Het
Fam198b	A	G	3: 79,941,464	N506D	possibly damaging	Het
Frs3	A	G	17: 47,702,978	T199A	probably benign	Het
Fsd1	A	G	17: 55,993,870	N243S	probably benign	Het
Gabra5	A	C	7: 57,408,893	L369R	probably benign	Het
Gins4	A	G	8: 23,234,776	V54A	probably benign	Het
Gli1	T	C	10: 127,334,269	E339G	possibly damaging	Het
Gm12185	A	G	11: 48,907,767	V633A	probably damaging	Het
Gm8251	A	G	1: 44,056,970	V1656A	probably benign	Het
Gm8765	G	A	13: 50,700,407		probably null	Het
Gpr83	T	A	9: 14,868,197	C182S	probably null	Het
Gspt1	A	G	16: 11,220,855	V627A	probably damaging	Het
Heatr1	T	C	13: 12,412,159	C722R	probably benign	Het
Jak1	C	T	4: 101,162,922	R680Q	probably damaging	Het
Kif2c	A	G	4: 117,169,940	V287A	probably damaging	Het
Kmo	C	T	1: 175,651,618	P240L	possibly damaging	Het
Kmo	A	G	1: 175,656,802	E366G	probably damaging	Het
Lepr	A	T	4: 101,789,344	N824I	probably damaging	Het
Lyrm7	T	A	11: 54,848,599	H75L	possibly damaging	Het
Map4k1	A	T	7: 28,991,036	Q351L	probably benign	Het
Mgam	T	C	6: 40,661,683	I450T	probably benign	Het
Nbeal2	A	G	9: 110,636,305	L955P	probably damaging	Het
Nlrp9c	T	C	7: 26,378,101	K752R	possibly damaging	Het
Nsmaf	A	T	4: 6,438,062	I70K	probably benign	Het
Olfr201	C	T	16: 59,268,944	C241Y	probably damaging	Het
Olfr298	A	G	7: 86,489,125	M142T	probably damaging	Het
Otud7a	A	G	7: 63,758,643	Y898C	probably damaging	Het
Pcdhb18	A	C	18: 37,490,892	D425A	probably damaging	Het
Prdm1	A	T	10: 44,439,986	L733*	probably null	Het
Prdm2	A	T	4: 143,135,583	I379N	probably damaging	Het
Ptprg	A	T	14: 12,220,596	Y436F	probably damaging	Het
Riok3	A	G	18: 12,137,306	D167G	probably damaging	Het
Rnf215	G	T	11: 4,135,451	R60L	probably damaging	Het
Sdk1	A	T	5: 141,999,950	H779L	probably benign	Het
Serpine2	A	G	1: 79,795,031	F390L	probably damaging	Het
Sh3d21	T	A	4: 126,151,726	K387*	probably null	Het
Slc13a2	T	C	11: 78,397,746	Y568C	possibly damaging	Het
Slc27a5	T	C	7: 12,988,459		probably null	Het
Slc32a1	T	C	2: 158,614,577	L384P	probably damaging	Het
Sorcs1	T	C	19: 50,252,587	N454D	probably benign	Het
Spag8	T	C	4: 43,652,777	Y228C	possibly damaging	Het
Spc25	T	C	2: 69,200,087	I71V	probably damaging	Het
Tcte1	T	A	17: 45,535,252	F261I	probably damaging	Het
Thsd7a	T	A	6: 12,471,175	K481N	probably benign	Het
Tll2	G	T	19: 41,086,400	N908K	probably benign	Het
Tmem236	T	C	2: 14,192,280	V93A	probably benign	Het
Top2b	G	A	14: 16,408,953		probably null	Het
Topaz1	G	A	9: 122,767,011	S949N	probably benign	Het
Triobp	A	G	15: 78,973,738	T1180A	probably benign	Het
Trip11	A	C	12: 101,886,160	D548E	probably benign	Het
Trpv2	T	A	11: 62,589,826		probably null	Het
Vmn1r12	T	A	6: 57,159,555	H212Q	probably damaging	Het
Vmn2r112	A	G	17: 22,618,903	T782A	possibly damaging	Het
Vmn2r7	A	G	3: 64,716,455	V239A	possibly damaging	Het
Vmn2r80	T	A	10: 79,194,219	N626K	probably damaging	Het
Vmn2r99	A	G	17: 19,380,060	S449G	probably benign	Het
Wfikkn2	T	C	11: 94,238,107	T403A	probably benign	Het
Xirp2	A	G	2: 67,515,679	I2755V	probably benign	Het
Yjefn3	A	G	8: 69,889,079	V153A	probably benign	Het
Zfp677	C	A	17: 21,397,237	H185Q	possibly damaging	Het
Zfp947	C	T	17: 22,146,292	V134I	probably benign	Het

Other mutations in Cdh23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Cdh23	APN	10	60523548	missense	probably benign	0.03
IGL00429:Cdh23	APN	10	60421141	missense	probably damaging	0.97
IGL01014:Cdh23	APN	10	60307522	missense	probably damaging	0.99
IGL01284:Cdh23	APN	10	60466097	missense	possibly damaging	0.95
IGL01305:Cdh23	APN	10	60312624	missense	probably damaging	1.00
IGL01367:Cdh23	APN	10	60310787	missense	probably damaging	1.00
IGL01396:Cdh23	APN	10	60385069	missense	possibly damaging	0.93
IGL01412:Cdh23	APN	10	60314694	missense	probably damaging	1.00
IGL01461:Cdh23	APN	10	60409147	missense	possibly damaging	0.53
IGL01469:Cdh23	APN	10	60597725	missense	probably benign	0.03
IGL01695:Cdh23	APN	10	60331833	missense	probably benign	0.20
IGL01734:Cdh23	APN	10	60303513	missense	probably benign
IGL01767:Cdh23	APN	10	60315724	missense	probably damaging	1.00
IGL01796:Cdh23	APN	10	60311137	missense	probably benign	0.31
IGL01843:Cdh23	APN	10	60419819	splice site	probably null
IGL02025:Cdh23	APN	10	60385143	missense	probably damaging	1.00
IGL02071:Cdh23	APN	10	60523560	missense	possibly damaging	0.93
IGL02160:Cdh23	APN	10	60597765	splice site	probably benign
IGL02175:Cdh23	APN	10	60331308	missense	possibly damaging	0.92
IGL02220:Cdh23	APN	10	60305124	missense	probably damaging	1.00
IGL02302:Cdh23	APN	10	60323523	missense	possibly damaging	0.87
IGL02331:Cdh23	APN	10	60465543	missense	probably damaging	0.99
IGL02452:Cdh23	APN	10	60317942	missense	probably damaging	0.99
IGL02499:Cdh23	APN	10	60385179	missense	probably damaging	1.00
IGL02548:Cdh23	APN	10	60650122	missense	probably benign	0.37
IGL02593:Cdh23	APN	10	60465995	splice site	probably benign
IGL02626:Cdh23	APN	10	60391801	missense	probably damaging	1.00
IGL02951:Cdh23	APN	10	60311364	missense	probably damaging	1.00
IGL03145:Cdh23	APN	10	60376814	missense	probably damaging	0.99
dee_dee	UTSW	10	60308056	nonsense	probably null
hersey	UTSW	10	60308036	missense	probably damaging	1.00
ANU22:Cdh23	UTSW	10	60312624	missense	probably damaging	1.00
IGL02980:Cdh23	UTSW	10	60314620	missense	probably damaging	1.00
PIT4362001:Cdh23	UTSW	10	60465458	missense	probably benign	0.15
R0013:Cdh23	UTSW	10	60413173	missense	possibly damaging	0.90
R0045:Cdh23	UTSW	10	60530978	missense	probably damaging	1.00
R0045:Cdh23	UTSW	10	60530978	missense	probably damaging	1.00
R0082:Cdh23	UTSW	10	60312587	missense	probably damaging	1.00
R0124:Cdh23	UTSW	10	60308056	nonsense	probably null
R0172:Cdh23	UTSW	10	60319632	missense	probably damaging	1.00
R0195:Cdh23	UTSW	10	60317059	missense	probably damaging	0.99
R0365:Cdh23	UTSW	10	60379315	missense	probably damaging	0.99
R0437:Cdh23	UTSW	10	60410797	missense	probably damaging	1.00
R0486:Cdh23	UTSW	10	60386946	missense	probably damaging	1.00
R0494:Cdh23	UTSW	10	60316596	splice site	probably benign
R0545:Cdh23	UTSW	10	60331291	missense	probably benign	0.06
R0619:Cdh23	UTSW	10	60433777	missense	probably damaging	1.00
R0647:Cdh23	UTSW	10	60307902	missense	probably damaging	0.99
R0647:Cdh23	UTSW	10	60323374	nonsense	probably null
R0730:Cdh23	UTSW	10	60323714	missense	probably damaging	0.99
R0880:Cdh23	UTSW	10	60406421	missense	possibly damaging	0.51
R0942:Cdh23	UTSW	10	60410860	missense	possibly damaging	0.67
R0989:Cdh23	UTSW	10	60534510	missense	probably damaging	0.99
R1017:Cdh23	UTSW	10	60331793	missense	probably damaging	1.00
R1173:Cdh23	UTSW	10	60312392	splice site	probably benign
R1449:Cdh23	UTSW	10	60376951	missense	probably damaging	1.00
R1456:Cdh23	UTSW	10	60487120	missense	possibly damaging	0.84
R1532:Cdh23	UTSW	10	60314331	missense	probably damaging	0.99
R1559:Cdh23	UTSW	10	60419699	splice site	probably benign
R1704:Cdh23	UTSW	10	60314611	missense	probably damaging	1.00
R1711:Cdh23	UTSW	10	60523536	missense	probably benign	0.07
R1760:Cdh23	UTSW	10	60326076	missense	probably damaging	1.00
R1782:Cdh23	UTSW	10	60488542	missense	probably damaging	1.00
R1791:Cdh23	UTSW	10	60391726	missense	possibly damaging	0.89
R1803:Cdh23	UTSW	10	60331281	missense	probably damaging	1.00
R1857:Cdh23	UTSW	10	60323297	missense	probably damaging	1.00
R1874:Cdh23	UTSW	10	60436818	missense	possibly damaging	0.52
R1914:Cdh23	UTSW	10	60323570	missense	probably damaging	0.99
R1958:Cdh23	UTSW	10	60410873	missense	probably benign	0.02
R1964:Cdh23	UTSW	10	60385222	missense	probably benign	0.31
R1966:Cdh23	UTSW	10	60323582	missense	probably damaging	1.00
R1981:Cdh23	UTSW	10	60378751	missense	probably damaging	1.00
R2010:Cdh23	UTSW	10	60314227	missense	probably damaging	0.99
R2036:Cdh23	UTSW	10	60466043	missense	possibly damaging	0.52
R2038:Cdh23	UTSW	10	60312587	missense	probably damaging	1.00
R2044:Cdh23	UTSW	10	60596730	missense	possibly damaging	0.72
R2111:Cdh23	UTSW	10	60305583	missense	probably damaging	0.99
R2112:Cdh23	UTSW	10	60305583	missense	probably damaging	0.99
R2211:Cdh23	UTSW	10	60466004	missense	possibly damaging	0.92
R2261:Cdh23	UTSW	10	60317128	missense	probably damaging	1.00
R2262:Cdh23	UTSW	10	60317128	missense	probably damaging	1.00
R2306:Cdh23	UTSW	10	60323445	missense	probably damaging	1.00
R2344:Cdh23	UTSW	10	60316724	missense	probably damaging	1.00
R2857:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2858:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2859:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2876:Cdh23	UTSW	10	60307496	missense	probably damaging	1.00
R3034:Cdh23	UTSW	10	60409010	splice site	probably benign
R3424:Cdh23	UTSW	10	60376881	missense	possibly damaging	0.76
R3699:Cdh23	UTSW	10	60327370	critical splice donor site	probably null
R3700:Cdh23	UTSW	10	60327370	critical splice donor site	probably null
R3950:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R3951:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R3952:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R4108:Cdh23	UTSW	10	60410822	missense	possibly damaging	0.51
R4114:Cdh23	UTSW	10	60421040	splice site	probably null
R4273:Cdh23	UTSW	10	60311161	missense	possibly damaging	0.69
R4284:Cdh23	UTSW	10	60303493	missense	possibly damaging	0.91
R4334:Cdh23	UTSW	10	60385059	missense	probably damaging	0.99
R4474:Cdh23	UTSW	10	60311086	missense	probably damaging	1.00
R4532:Cdh23	UTSW	10	60534423	missense	probably benign	0.32
R4597:Cdh23	UTSW	10	60409044	missense	probably damaging	1.00
R4604:Cdh23	UTSW	10	60337666	missense	possibly damaging	0.93
R4793:Cdh23	UTSW	10	60331350	missense	probably damaging	1.00
R4816:Cdh23	UTSW	10	60409077	missense	possibly damaging	0.93
R4833:Cdh23	UTSW	10	60385038	missense	probably damaging	1.00
R4840:Cdh23	UTSW	10	60419777	missense	possibly damaging	0.53
R4857:Cdh23	UTSW	10	60391784	missense	probably damaging	1.00
R4869:Cdh23	UTSW	10	60376934	missense	probably damaging	1.00
R4894:Cdh23	UTSW	10	60337851	missense	probably benign	0.04
R4940:Cdh23	UTSW	10	60307935	missense	probably damaging	0.98
R5020:Cdh23	UTSW	10	60308032	missense	probably damaging	0.99
R5026:Cdh23	UTSW	10	60304848	missense	possibly damaging	0.88
R5081:Cdh23	UTSW	10	60436807	missense	possibly damaging	0.89
R5138:Cdh23	UTSW	10	60312282	missense	probably damaging	1.00
R5236:Cdh23	UTSW	10	60312572	missense	probably damaging	1.00
R5361:Cdh23	UTSW	10	60657265	critical splice donor site	probably null
R5384:Cdh23	UTSW	10	60337762	missense	probably damaging	0.99
R5500:Cdh23	UTSW	10	60314311	missense	probably damaging	1.00
R5512:Cdh23	UTSW	10	60534386	splice site	probably null
R5673:Cdh23	UTSW	10	60307857	missense	probably damaging	1.00
R5720:Cdh23	UTSW	10	60393023	missense	possibly damaging	0.71
R5726:Cdh23	UTSW	10	60407480	missense	probably damaging	0.98
R5732:Cdh23	UTSW	10	60331317	missense	possibly damaging	0.80
R5739:Cdh23	UTSW	10	60305609	missense	probably damaging	0.99
R5760:Cdh23	UTSW	10	60406392	missense	probably damaging	0.99
R5793:Cdh23	UTSW	10	60306128	missense	probably damaging	1.00
R5880:Cdh23	UTSW	10	60384934	missense	probably damaging	1.00
R5905:Cdh23	UTSW	10	60534535	missense	probably damaging	0.98
R5907:Cdh23	UTSW	10	60428379	missense	probably damaging	1.00
R5910:Cdh23	UTSW	10	60377821	missense	possibly damaging	0.81
R5932:Cdh23	UTSW	10	60392984	missense	probably damaging	1.00
R5996:Cdh23	UTSW	10	60413577	missense	possibly damaging	0.85
R6015:Cdh23	UTSW	10	60307982	missense	probably damaging	0.97
R6020:Cdh23	UTSW	10	60331326	missense	probably damaging	1.00
R6023:Cdh23	UTSW	10	60465542	missense	probably damaging	1.00
R6028:Cdh23	UTSW	10	60534535	missense	probably damaging	0.98
R6066:Cdh23	UTSW	10	60433758	missense	probably damaging	1.00
R6137:Cdh23	UTSW	10	60434512	missense	probably damaging	0.96
R6211:Cdh23	UTSW	10	60410821	missense	possibly damaging	0.90
R6298:Cdh23	UTSW	10	60426672	nonsense	probably null
R6302:Cdh23	UTSW	10	60305093	missense	possibly damaging	0.74
R6338:Cdh23	UTSW	10	60413151	missense	probably damaging	1.00
R6356:Cdh23	UTSW	10	60438847	missense	probably damaging	1.00
R6441:Cdh23	UTSW	10	60308036	missense	probably damaging	1.00
R6714:Cdh23	UTSW	10	60331830	missense	possibly damaging	0.62
R6760:Cdh23	UTSW	10	60306168	missense	probably damaging	1.00
R6807:Cdh23	UTSW	10	60378871	missense	possibly damaging	0.95
R6855:Cdh23	UTSW	10	60306122	missense	possibly damaging	0.66
R6937:Cdh23	UTSW	10	60487114	missense	probably damaging	1.00
R6942:Cdh23	UTSW	10	60438856	missense	possibly damaging	0.93
R6961:Cdh23	UTSW	10	60650114	missense	probably benign	0.00
R7009:Cdh23	UTSW	10	60337306	missense	probably damaging	0.99
R7010:Cdh23	UTSW	10	60530991	missense	probably benign	0.03
R7032:Cdh23	UTSW	10	60331788	missense	probably damaging	1.00
R7046:Cdh23	UTSW	10	60378751	missense	probably damaging	1.00
R7111:Cdh23	UTSW	10	60387044	missense	probably damaging	1.00
R7196:Cdh23	UTSW	10	60307980	missense	probably damaging	0.99
R7198:Cdh23	UTSW	10	60312599	missense	possibly damaging	0.91
R7223:Cdh23	UTSW	10	60331817	missense	probably damaging	1.00
R7290:Cdh23	UTSW	10	60376841	missense	probably benign
R7335:Cdh23	UTSW	10	60305116	missense	probably damaging	1.00
R7340:Cdh23	UTSW	10	60530996	missense	probably benign	0.19
R7350:Cdh23	UTSW	10	60410910	missense	probably damaging	1.00
R7366:Cdh23	UTSW	10	60315692	nonsense	probably null
R7374:Cdh23	UTSW	10	60317900	missense	probably damaging	0.99
R7455:Cdh23	UTSW	10	60306224	missense	possibly damaging	0.82
R7537:Cdh23	UTSW	10	60384945	missense	probably benign	0.17
R7573:Cdh23	UTSW	10	60323550	missense	probably benign	0.17
R7578:Cdh23	UTSW	10	60407407	missense	probably benign	0.14
R7646:Cdh23	UTSW	10	60305152	missense	possibly damaging	0.95
R7703:Cdh23	UTSW	10	60337264	missense	probably damaging	1.00
R7763:Cdh23	UTSW	10	60312577	missense	probably damaging	1.00
R7797:Cdh23	UTSW	10	60385194	missense	probably benign	0.07
R7867:Cdh23	UTSW	10	60314611	missense	probably damaging	1.00
R7878:Cdh23	UTSW	10	60314200	missense	possibly damaging	0.69
R7915:Cdh23	UTSW	10	60307889	missense	probably damaging	0.97
R7922:Cdh23	UTSW	10	60382706	missense	probably benign	0.31
R7963:Cdh23	UTSW	10	60336188	missense	probably damaging	1.00
R7997:Cdh23	UTSW	10	60596739	missense	possibly damaging	0.81
R8167:Cdh23	UTSW	10	60314383	missense	probably benign	0.12
R8167:Cdh23	UTSW	10	60337693	missense	probably damaging	0.96
R8258:Cdh23	UTSW	10	60315656	missense	probably damaging	0.99
R8259:Cdh23	UTSW	10	60315656	missense	probably damaging	0.99
R8317:Cdh23	UTSW	10	60311258	critical splice donor site	probably null
R8317:Cdh23	UTSW	10	60436789	missense	probably damaging	1.00
R8326:Cdh23	UTSW	10	60438812	missense	possibly damaging	0.55
R8333:Cdh23	UTSW	10	60314611	missense	probably damaging	1.00
R8348:Cdh23	UTSW	10	60331728	missense	probably benign	0.43
R8366:Cdh23	UTSW	10	60325020	missense	probably benign
R8504:Cdh23	UTSW	10	60438839	missense	probably benign	0.00
R8676:Cdh23	UTSW	10	60410910	missense	probably damaging	1.00
R8781:Cdh23	UTSW	10	60331788	missense	probably damaging	1.00
R8785:Cdh23	UTSW	10	60311335	missense	probably damaging	1.00
R8788:Cdh23	UTSW	10	60488593	missense	probably damaging	1.00
R8802:Cdh23	UTSW	10	60409098	missense	probably benign	0.04
R8837:Cdh23	UTSW	10	60324976	missense	probably benign	0.28
R8863:Cdh23	UTSW	10	60376834	nonsense	probably null
R8889:Cdh23	UTSW	10	60307505	missense	probably damaging	0.97
R8892:Cdh23	UTSW	10	60307505	missense	probably damaging	0.97
R8921:Cdh23	UTSW	10	60305129	missense	probably damaging	0.99
R8980:Cdh23	UTSW	10	60337846	missense	probably benign	0.06
R9000:Cdh23	UTSW	10	60304498	missense	possibly damaging	0.82
R9043:Cdh23	UTSW	10	60315699	missense	probably benign	0.00
R9046:Cdh23	UTSW	10	60382524	intron	probably benign
R9070:Cdh23	UTSW	10	60337760	missense	probably benign
R9075:Cdh23	UTSW	10	60317762	missense	probably damaging	1.00
R9132:Cdh23	UTSW	10	60434504	splice site	probably benign
R9155:Cdh23	UTSW	10	60413706	missense	probably damaging	0.99
R9171:Cdh23	UTSW	10	60326031	missense	probably benign	0.00
R9179:Cdh23	UTSW	10	60317885	missense	probably benign	0.06
R9186:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9189:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9207:Cdh23	UTSW	10	60407431	missense	probably damaging	1.00
R9240:Cdh23	UTSW	10	60379265	missense	probably benign	0.00
R9244:Cdh23	UTSW	10	60413663	missense	possibly damaging	0.93
R9284:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9286:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9287:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9302:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9352:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9353:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9423:Cdh23	UTSW	10	60312608	missense	probably damaging	1.00
R9513:Cdh23	UTSW	10	60331216	missense	probably damaging	0.99
R9577:Cdh23	UTSW	10	60311116	missense	probably damaging	1.00
R9598:Cdh23	UTSW	10	60378795	missense	probably benign	0.01
R9631:Cdh23	UTSW	10	60407389	missense	possibly damaging	0.49
R9652:Cdh23	UTSW	10	60331356	missense	probably damaging	1.00
R9725:Cdh23	UTSW	10	60596782	missense	probably benign	0.02
X0052:Cdh23	UTSW	10	60385134	missense	probably damaging	1.00
Z1088:Cdh23	UTSW	10	60413644	missense	probably benign	0.35
Z1176:Cdh23	UTSW	10	60310770	missense	probably damaging	1.00
Z1176:Cdh23	UTSW	10	60428321	missense	probably benign
Z1177:Cdh23	UTSW	10	60323555	missense	possibly damaging	0.80
Z1177:Cdh23	UTSW	10	60434614	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CGCTTGCTAACACAAAGCTTGCTG -3'
(R):5'- CTTCATTCCCATGAGCTGGAACCC -3'

Sequencing Primer
(F):5'- AAAGCTTGCTGGCTCAGAC -3'
(R):5'- cacacacacacacgcac -3'

Posted On

2014-04-13