Incidental Mutation 'R1519:Acadvl'
ID167308
Institutional Source Beutler Lab
Gene Symbol Acadvl
Ensembl Gene ENSMUSG00000018574
Gene Nameacyl-Coenzyme A dehydrogenase, very long chain
SynonymsVLCAD
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R1519 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70010183-70015411 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 70014791 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018718] [ENSMUST00000019362] [ENSMUST00000102574] [ENSMUST00000102575] [ENSMUST00000108588] [ENSMUST00000108589] [ENSMUST00000123687] [ENSMUST00000133140] [ENSMUST00000134376] [ENSMUST00000231221] [ENSMUST00000231415] [ENSMUST00000232002] [ENSMUST00000231506] [ENSMUST00000190940]
Predicted Effect probably benign
Transcript: ENSMUST00000018718
SMART Domains Protein: ENSMUSP00000018718
Gene: ENSMUSG00000018574

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 74 188 4.4e-22 PFAM
Pfam:Acyl-CoA_dh_M 192 245 5.1e-20 PFAM
Pfam:Acyl-CoA_dh_1 306 455 6.7e-41 PFAM
Pfam:Acyl-CoA_dh_2 321 445 2.8e-12 PFAM
Blast:HisKA 460 557 6e-10 BLAST
low complexity region 558 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019362
SMART Domains Protein: ENSMUSP00000019362
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
Pfam:Dishevelled 103 263 1.5e-60 PFAM
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.1e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083600
Predicted Effect probably null
Transcript: ENSMUST00000102574
SMART Domains Protein: ENSMUSP00000099634
Gene: ENSMUSG00000018574

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 96 210 2.5e-25 PFAM
Pfam:Acyl-CoA_dh_M 214 316 5.5e-25 PFAM
Pfam:Acyl-CoA_dh_1 328 477 2.5e-41 PFAM
Pfam:Acyl-CoA_dh_2 343 467 8.7e-14 PFAM
Blast:HisKA 482 579 7e-10 BLAST
low complexity region 580 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102575
SMART Domains Protein: ENSMUSP00000099635
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Dishevelled 160 232 8.1e-27 PFAM
low complexity region 250 262 N/A INTRINSIC
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.3e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108586
Predicted Effect probably benign
Transcript: ENSMUST00000108588
SMART Domains Protein: ENSMUSP00000104229
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
MAGUK_N_PEST 10 61 1e-7 SMART
PDZ 70 149 3.38e-21 SMART
PDZ 165 244 1.12e-21 SMART
PDZ 318 391 4.13e-25 SMART
SH3 428 494 1.68e-9 SMART
GuKc 530 709 3.65e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108589
SMART Domains Protein: ENSMUSP00000104230
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
MAGUK_N_PEST 53 107 1.36e-4 SMART
PDZ 116 195 3.38e-21 SMART
PDZ 211 290 1.12e-21 SMART
PDZ 364 437 4.13e-25 SMART
SH3 474 540 1.68e-9 SMART
GuKc 576 755 3.65e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123687
SMART Domains Protein: ENSMUSP00000134545
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
SH3 11 77 1.68e-9 SMART
GuKc 113 205 7.37e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133140
SMART Domains Protein: ENSMUSP00000126707
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
PDZ 13 92 3.38e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134376
SMART Domains Protein: ENSMUSP00000115206
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
MAGUK_N_PEST 10 97 3.39e-37 SMART
PDZ 106 165 1.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146129
Predicted Effect probably benign
Transcript: ENSMUST00000231221
Predicted Effect probably benign
Transcript: ENSMUST00000231415
Predicted Effect probably benign
Transcript: ENSMUST00000232002
Predicted Effect probably benign
Transcript: ENSMUST00000231506
Predicted Effect probably benign
Transcript: ENSMUST00000190940
SMART Domains Protein: ENSMUSP00000140073
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Dishevelled 160 232 8.1e-27 PFAM
low complexity region 250 262 N/A INTRINSIC
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.3e-79 PFAM
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homodimeric mitochondrial flavoprotein and is a member of the acyl-CoA dehydrogenase family. Members of this family catalyze the first step of fatty acid beta-oxidation, forming a C2-C3 trans-double bond in a FAD-dependent reaction. As beta-oxidation cycles through its four steps, each member of the acyl-CoA dehydrogenase family works at an optimum fatty acid chain-length. This enzyme has its optimum length between C16- and C20-acylCoA and localizes to the inner mitochondrial membrane (unlike related acyl-CoA dehydrogenases). In mice, deficiency of this gene can cause ventricular arrhythmias as well as fasting and cold intolerance. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutant animals exhibit mild steatosis, lipid accumulation in myocytes, increased fatigue, impaired temperature regulation, increased susceptibility to arrhythmia, accumulation of long-chain acylcarnitines, and lower free carnitine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
9230019H11Rik A G 10: 3,125,230 noncoding transcript Het
9530077C05Rik T G 9: 22,430,375 L114R probably benign Het
Abhd5 T C 9: 122,379,014 probably null Het
Actn1 T C 12: 80,205,078 E75G probably damaging Het
Adam4 A T 12: 81,420,877 N323K possibly damaging Het
Anks6 G A 4: 47,027,152 R689W probably damaging Het
Anxa2 T C 9: 69,485,241 I124T probably damaging Het
Aph1c T C 9: 66,833,265 T10A probably benign Het
Arhgap40 T A 2: 158,546,801 W552R probably benign Het
Baz2b C T 2: 59,948,254 R754H possibly damaging Het
Blmh A G 11: 76,966,781 Y147C probably damaging Het
C1galt1 C T 6: 7,866,402 L83F probably damaging Het
Cd163l1 G A 7: 140,228,156 V747I probably benign Het
Cdh23 A T 10: 60,379,343 Y1403N possibly damaging Het
Cic A T 7: 25,293,810 probably null Het
Coro1b T A 19: 4,150,584 V200D possibly damaging Het
Csl T A 10: 99,757,955 E416V probably damaging Het
Cyp3a25 A G 5: 146,001,447 probably null Het
Dennd2d T A 3: 106,492,559 F266Y probably damaging Het
Dnah10 A G 5: 124,760,952 E1072G probably damaging Het
Dnah6 T A 6: 73,049,048 K3435N probably damaging Het
Dnah9 G A 11: 65,881,761 A3715V probably damaging Het
Fam186a G A 15: 99,947,655 S236L unknown Het
Fam198b A G 3: 79,941,464 N506D possibly damaging Het
Frs3 A G 17: 47,702,978 T199A probably benign Het
Fsd1 A G 17: 55,993,870 N243S probably benign Het
Gabra5 A C 7: 57,408,893 L369R probably benign Het
Gins4 A G 8: 23,234,776 V54A probably benign Het
Gli1 T C 10: 127,334,269 E339G possibly damaging Het
Gm12185 A G 11: 48,907,767 V633A probably damaging Het
Gm8251 A G 1: 44,056,970 V1656A probably benign Het
Gm8765 G A 13: 50,700,407 probably null Het
Gpr83 T A 9: 14,868,197 C182S probably null Het
Gspt1 A G 16: 11,220,855 V627A probably damaging Het
Heatr1 T C 13: 12,412,159 C722R probably benign Het
Jak1 C T 4: 101,162,922 R680Q probably damaging Het
Kif2c A G 4: 117,169,940 V287A probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Kmo A G 1: 175,656,802 E366G probably damaging Het
Lepr A T 4: 101,789,344 N824I probably damaging Het
Lyrm7 T A 11: 54,848,599 H75L possibly damaging Het
Map4k1 A T 7: 28,991,036 Q351L probably benign Het
Mgam T C 6: 40,661,683 I450T probably benign Het
Nbeal2 A G 9: 110,636,305 L955P probably damaging Het
Nlrp9c T C 7: 26,378,101 K752R possibly damaging Het
Nsmaf A T 4: 6,438,062 I70K probably benign Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr298 A G 7: 86,489,125 M142T probably damaging Het
Otud7a A G 7: 63,758,643 Y898C probably damaging Het
Pcdhb18 A C 18: 37,490,892 D425A probably damaging Het
Prdm1 A T 10: 44,439,986 L733* probably null Het
Prdm2 A T 4: 143,135,583 I379N probably damaging Het
Ptprg A T 14: 12,220,596 Y436F probably damaging Het
Riok3 A G 18: 12,137,306 D167G probably damaging Het
Rnf215 G T 11: 4,135,451 R60L probably damaging Het
Sdk1 A T 5: 141,999,950 H779L probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sh3d21 T A 4: 126,151,726 K387* probably null Het
Slc13a2 T C 11: 78,397,746 Y568C possibly damaging Het
Slc27a5 T C 7: 12,988,459 probably null Het
Slc32a1 T C 2: 158,614,577 L384P probably damaging Het
Sorcs1 T C 19: 50,252,587 N454D probably benign Het
Spag8 T C 4: 43,652,777 Y228C possibly damaging Het
Spc25 T C 2: 69,200,087 I71V probably damaging Het
Tcte1 T A 17: 45,535,252 F261I probably damaging Het
Thsd7a T A 6: 12,471,175 K481N probably benign Het
Tll2 G T 19: 41,086,400 N908K probably benign Het
Tmem236 T C 2: 14,192,280 V93A probably benign Het
Top2b G A 14: 16,408,953 probably null Het
Topaz1 G A 9: 122,767,011 S949N probably benign Het
Triobp A G 15: 78,973,738 T1180A probably benign Het
Trip11 A C 12: 101,886,160 D548E probably benign Het
Trpv2 T A 11: 62,589,826 probably null Het
Vmn1r12 T A 6: 57,159,555 H212Q probably damaging Het
Vmn2r112 A G 17: 22,618,903 T782A possibly damaging Het
Vmn2r7 A G 3: 64,716,455 V239A possibly damaging Het
Vmn2r80 T A 10: 79,194,219 N626K probably damaging Het
Vmn2r99 A G 17: 19,380,060 S449G probably benign Het
Wfikkn2 T C 11: 94,238,107 T403A probably benign Het
Xirp2 A G 2: 67,515,679 I2755V probably benign Het
Yjefn3 A G 8: 69,889,079 V153A probably benign Het
Zfp677 C A 17: 21,397,237 H185Q possibly damaging Het
Zfp947 C T 17: 22,146,292 V134I probably benign Het
Other mutations in Acadvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03391:Acadvl APN 11 70010716 missense probably damaging 0.99
IGL03396:Acadvl APN 11 70011413 nonsense probably null
R1122:Acadvl UTSW 11 70011377 missense probably damaging 1.00
R1271:Acadvl UTSW 11 70014700 missense probably damaging 1.00
R1435:Acadvl UTSW 11 70014816 missense probably benign 0.00
R1710:Acadvl UTSW 11 70010355 missense probably damaging 1.00
R1853:Acadvl UTSW 11 70010870 missense probably damaging 1.00
R4747:Acadvl UTSW 11 70012508 missense probably damaging 1.00
R4822:Acadvl UTSW 11 70011184 missense probably benign 0.01
R5700:Acadvl UTSW 11 70013203 missense probably damaging 0.99
R6312:Acadvl UTSW 11 70011767 missense probably damaging 0.99
R6482:Acadvl UTSW 11 70011562 missense probably benign 0.00
R6489:Acadvl UTSW 11 70010319 missense probably benign 0.00
R6904:Acadvl UTSW 11 70014333 missense probably benign 0.31
R7009:Acadvl UTSW 11 70014791 critical splice donor site probably null
R7623:Acadvl UTSW 11 70010743 missense probably damaging 1.00
R8103:Acadvl UTSW 11 70014342 missense probably benign 0.00
R8439:Acadvl UTSW 11 70011728 nonsense probably null
R8556:Acadvl UTSW 11 70013550 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACCAGCTCTTTGAGAAATTGTGCC -3'
(R):5'- AGAAATGCGAGTTGCCAGTTCCC -3'

Sequencing Primer
(F):5'- CTTCACTGAGCACTGTATAATGGG -3'
(R):5'- GCAGTTCTGTCACTGAAAGTAG -3'
Posted On2014-04-13