Incidental Mutation 'R1519:Slc13a2'
ID 167310
Institutional Source Beutler Lab
Gene Symbol Slc13a2
Ensembl Gene ENSMUSG00000001095
Gene Name solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2
Synonyms sodium/dicarboxylate co-transporter, Nadc1, mNaDC-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1519 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 78397087-78422217 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78397746 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 568 (Y568C)
Ref Sequence ENSEMBL: ENSMUSP00000001122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001122]
AlphaFold Q9ES88
Predicted Effect possibly damaging
Transcript: ENSMUST00000001122
AA Change: Y568C

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001122
Gene: ENSMUSG00000001095
AA Change: Y568C

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 6 560 7.1e-161 PFAM
Pfam:CitMHS 45 164 3e-15 PFAM
Pfam:CitMHS 203 499 1.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149865
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-coupled citrate transporter that is regulated by the chaperone activity of cyclophilin b. The encoded protein may play a role in the formation of kidney stones. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased Kreb cycle intermediates in the urine but otherwise have normal kidney function and response to ischemia-reperfusion injury and caloric restriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
9230019H11Rik A G 10: 3,125,230 noncoding transcript Het
9530077C05Rik T G 9: 22,430,375 L114R probably benign Het
Abhd5 T C 9: 122,379,014 probably null Het
Acadvl A G 11: 70,014,791 probably null Het
Actn1 T C 12: 80,205,078 E75G probably damaging Het
Adam4 A T 12: 81,420,877 N323K possibly damaging Het
Anks6 G A 4: 47,027,152 R689W probably damaging Het
Anxa2 T C 9: 69,485,241 I124T probably damaging Het
Aph1c T C 9: 66,833,265 T10A probably benign Het
Arhgap40 T A 2: 158,546,801 W552R probably benign Het
Baz2b C T 2: 59,948,254 R754H possibly damaging Het
Blmh A G 11: 76,966,781 Y147C probably damaging Het
C1galt1 C T 6: 7,866,402 L83F probably damaging Het
Cd163l1 G A 7: 140,228,156 V747I probably benign Het
Cdh23 A T 10: 60,379,343 Y1403N possibly damaging Het
Cic A T 7: 25,293,810 probably null Het
Coro1b T A 19: 4,150,584 V200D possibly damaging Het
Csl T A 10: 99,757,955 E416V probably damaging Het
Cyp3a25 A G 5: 146,001,447 probably null Het
Dennd2d T A 3: 106,492,559 F266Y probably damaging Het
Dnah10 A G 5: 124,760,952 E1072G probably damaging Het
Dnah6 T A 6: 73,049,048 K3435N probably damaging Het
Dnah9 G A 11: 65,881,761 A3715V probably damaging Het
Fam186a G A 15: 99,947,655 S236L unknown Het
Fam198b A G 3: 79,941,464 N506D possibly damaging Het
Frs3 A G 17: 47,702,978 T199A probably benign Het
Fsd1 A G 17: 55,993,870 N243S probably benign Het
Gabra5 A C 7: 57,408,893 L369R probably benign Het
Gins4 A G 8: 23,234,776 V54A probably benign Het
Gli1 T C 10: 127,334,269 E339G possibly damaging Het
Gm12185 A G 11: 48,907,767 V633A probably damaging Het
Gm8251 A G 1: 44,056,970 V1656A probably benign Het
Gm8765 G A 13: 50,700,407 probably null Het
Gpr83 T A 9: 14,868,197 C182S probably null Het
Gspt1 A G 16: 11,220,855 V627A probably damaging Het
Heatr1 T C 13: 12,412,159 C722R probably benign Het
Jak1 C T 4: 101,162,922 R680Q probably damaging Het
Kif2c A G 4: 117,169,940 V287A probably damaging Het
Kmo A G 1: 175,656,802 E366G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lepr A T 4: 101,789,344 N824I probably damaging Het
Lyrm7 T A 11: 54,848,599 H75L possibly damaging Het
Map4k1 A T 7: 28,991,036 Q351L probably benign Het
Mgam T C 6: 40,661,683 I450T probably benign Het
Nbeal2 A G 9: 110,636,305 L955P probably damaging Het
Nlrp9c T C 7: 26,378,101 K752R possibly damaging Het
Nsmaf A T 4: 6,438,062 I70K probably benign Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr298 A G 7: 86,489,125 M142T probably damaging Het
Otud7a A G 7: 63,758,643 Y898C probably damaging Het
Pcdhb18 A C 18: 37,490,892 D425A probably damaging Het
Prdm1 A T 10: 44,439,986 L733* probably null Het
Prdm2 A T 4: 143,135,583 I379N probably damaging Het
Ptprg A T 14: 12,220,596 Y436F probably damaging Het
Riok3 A G 18: 12,137,306 D167G probably damaging Het
Rnf215 G T 11: 4,135,451 R60L probably damaging Het
Sdk1 A T 5: 141,999,950 H779L probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sh3d21 T A 4: 126,151,726 K387* probably null Het
Slc27a5 T C 7: 12,988,459 probably null Het
Slc32a1 T C 2: 158,614,577 L384P probably damaging Het
Sorcs1 T C 19: 50,252,587 N454D probably benign Het
Spag8 T C 4: 43,652,777 Y228C possibly damaging Het
Spc25 T C 2: 69,200,087 I71V probably damaging Het
Tcte1 T A 17: 45,535,252 F261I probably damaging Het
Thsd7a T A 6: 12,471,175 K481N probably benign Het
Tll2 G T 19: 41,086,400 N908K probably benign Het
Tmem236 T C 2: 14,192,280 V93A probably benign Het
Top2b G A 14: 16,408,953 probably null Het
Topaz1 G A 9: 122,767,011 S949N probably benign Het
Triobp A G 15: 78,973,738 T1180A probably benign Het
Trip11 A C 12: 101,886,160 D548E probably benign Het
Trpv2 T A 11: 62,589,826 probably null Het
Vmn1r12 T A 6: 57,159,555 H212Q probably damaging Het
Vmn2r112 A G 17: 22,618,903 T782A possibly damaging Het
Vmn2r7 A G 3: 64,716,455 V239A possibly damaging Het
Vmn2r80 T A 10: 79,194,219 N626K probably damaging Het
Vmn2r99 A G 17: 19,380,060 S449G probably benign Het
Wfikkn2 T C 11: 94,238,107 T403A probably benign Het
Xirp2 A G 2: 67,515,679 I2755V probably benign Het
Yjefn3 A G 8: 69,889,079 V153A probably benign Het
Zfp677 C A 17: 21,397,237 H185Q possibly damaging Het
Zfp947 C T 17: 22,146,292 V134I probably benign Het
Other mutations in Slc13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Slc13a2 APN 11 78400548 missense probably damaging 1.00
IGL01604:Slc13a2 APN 11 78403395 missense possibly damaging 0.82
IGL01679:Slc13a2 APN 11 78404711 missense probably damaging 1.00
IGL03100:Slc13a2 APN 11 78404473 missense probably damaging 1.00
IGL03380:Slc13a2 APN 11 78399082 missense probably benign 0.03
deliberate UTSW 11 78403480 critical splice acceptor site probably benign
Familiaris UTSW 11 78404795 missense probably damaging 1.00
intentional UTSW 11 78404708 missense probably damaging 1.00
R0085:Slc13a2 UTSW 11 78406868 missense probably damaging 0.96
R0324:Slc13a2 UTSW 11 78404524 missense probably damaging 1.00
R0368:Slc13a2 UTSW 11 78404800 nonsense probably null
R0440:Slc13a2 UTSW 11 78403175 missense probably benign 0.05
R0539:Slc13a2 UTSW 11 78399138 missense probably damaging 1.00
R1550:Slc13a2 UTSW 11 78403164 missense probably damaging 1.00
R1909:Slc13a2 UTSW 11 78400142 missense possibly damaging 0.90
R2166:Slc13a2 UTSW 11 78403075 missense probably benign 0.16
R2994:Slc13a2 UTSW 11 78404737 missense probably damaging 1.00
R2998:Slc13a2 UTSW 11 78404785 missense probably damaging 0.99
R3418:Slc13a2 UTSW 11 78400840 missense probably benign 0.05
R3932:Slc13a2 UTSW 11 78398400 missense probably damaging 1.00
R4233:Slc13a2 UTSW 11 78403535 intron probably benign
R4462:Slc13a2 UTSW 11 78404387 missense probably benign 0.44
R5014:Slc13a2 UTSW 11 78400161 missense possibly damaging 0.73
R5170:Slc13a2 UTSW 11 78400808 missense probably damaging 1.00
R5484:Slc13a2 UTSW 11 78404822 splice site probably benign
R5809:Slc13a2 UTSW 11 78397821 missense probably damaging 1.00
R5973:Slc13a2 UTSW 11 78400532 missense probably damaging 0.99
R6243:Slc13a2 UTSW 11 78404708 missense probably damaging 1.00
R6263:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6275:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6276:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6279:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6280:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6300:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6305:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6314:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6673:Slc13a2 UTSW 11 78397831 missense probably benign 0.12
R7138:Slc13a2 UTSW 11 78399124 missense possibly damaging 0.76
R7382:Slc13a2 UTSW 11 78404795 missense probably damaging 1.00
R7657:Slc13a2 UTSW 11 78398397 missense probably damaging 0.99
R7791:Slc13a2 UTSW 11 78422064 critical splice donor site probably null
R8027:Slc13a2 UTSW 11 78404756 missense probably benign 0.00
R9091:Slc13a2 UTSW 11 78404432 missense probably damaging 1.00
R9270:Slc13a2 UTSW 11 78404432 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACACGAGCATCTTCCTCTTCAC -3'
(R):5'- ACTGAACCTGAAGGCAGGACTTCC -3'

Sequencing Primer
(F):5'- CTCTTCACCGGAGAGCAC -3'
(R):5'- TTCCCAAGGAGGGCTTTGC -3'
Posted On 2014-04-13