Mutagenetix > Incidental Mutation

Incidental Mutation 'R1519:Slc13a2'

167310

Institutional Source

Beutler Lab

Gene Symbol

Slc13a2

Ensembl Gene

ENSMUSG00000001095

Gene Name

solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2

Synonyms

sodium/dicarboxylate co-transporter, Nadc1, mNaDC-1

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1519 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78397087-78422217 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78397746 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 568 (Y568C)

Ref Sequence

ENSEMBL: ENSMUSP00000001122 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001122]

AlphaFold

Q9ES88

Predicted Effect

possibly damaging
Transcript: ENSMUST00000001122
AA Change: Y568C

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000001122
Gene: ENSMUSG00000001095
AA Change: Y568C

Domain	Start	End	E-Value	Type
Pfam:Na_sulph_symp	6	560	7.1e-161	PFAM
Pfam:CitMHS	45	164	3e-15	PFAM
Pfam:CitMHS	203	499	1.5e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149865

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-coupled citrate transporter that is regulated by the chaperone activity of cyclophilin b. The encoded protein may play a role in the formation of kidney stones. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased Kreb cycle intermediates in the urine but otherwise have normal kidney function and response to ischemia-reperfusion injury and caloric restriction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	C	G	10: 100,603,528	P187R	probably damaging	Het
9230019H11Rik	A	G	10: 3,125,230		noncoding transcript	Het
9530077C05Rik	T	G	9: 22,430,375	L114R	probably benign	Het
Abhd5	T	C	9: 122,379,014		probably null	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Actn1	T	C	12: 80,205,078	E75G	probably damaging	Het
Adam4	A	T	12: 81,420,877	N323K	possibly damaging	Het
Anks6	G	A	4: 47,027,152	R689W	probably damaging	Het
Anxa2	T	C	9: 69,485,241	I124T	probably damaging	Het
Aph1c	T	C	9: 66,833,265	T10A	probably benign	Het
Arhgap40	T	A	2: 158,546,801	W552R	probably benign	Het
Baz2b	C	T	2: 59,948,254	R754H	possibly damaging	Het
Blmh	A	G	11: 76,966,781	Y147C	probably damaging	Het
C1galt1	C	T	6: 7,866,402	L83F	probably damaging	Het
Cd163l1	G	A	7: 140,228,156	V747I	probably benign	Het
Cdh23	A	T	10: 60,379,343	Y1403N	possibly damaging	Het
Cic	A	T	7: 25,293,810		probably null	Het
Coro1b	T	A	19: 4,150,584	V200D	possibly damaging	Het
Csl	T	A	10: 99,757,955	E416V	probably damaging	Het
Cyp3a25	A	G	5: 146,001,447		probably null	Het
Dennd2d	T	A	3: 106,492,559	F266Y	probably damaging	Het
Dnah10	A	G	5: 124,760,952	E1072G	probably damaging	Het
Dnah6	T	A	6: 73,049,048	K3435N	probably damaging	Het
Dnah9	G	A	11: 65,881,761	A3715V	probably damaging	Het
Fam186a	G	A	15: 99,947,655	S236L	unknown	Het
Fam198b	A	G	3: 79,941,464	N506D	possibly damaging	Het
Frs3	A	G	17: 47,702,978	T199A	probably benign	Het
Fsd1	A	G	17: 55,993,870	N243S	probably benign	Het
Gabra5	A	C	7: 57,408,893	L369R	probably benign	Het
Gins4	A	G	8: 23,234,776	V54A	probably benign	Het
Gli1	T	C	10: 127,334,269	E339G	possibly damaging	Het
Gm12185	A	G	11: 48,907,767	V633A	probably damaging	Het
Gm8251	A	G	1: 44,056,970	V1656A	probably benign	Het
Gm8765	G	A	13: 50,700,407		probably null	Het
Gpr83	T	A	9: 14,868,197	C182S	probably null	Het
Gspt1	A	G	16: 11,220,855	V627A	probably damaging	Het
Heatr1	T	C	13: 12,412,159	C722R	probably benign	Het
Jak1	C	T	4: 101,162,922	R680Q	probably damaging	Het
Kif2c	A	G	4: 117,169,940	V287A	probably damaging	Het
Kmo	C	T	1: 175,651,618	P240L	possibly damaging	Het
Kmo	A	G	1: 175,656,802	E366G	probably damaging	Het
Lepr	A	T	4: 101,789,344	N824I	probably damaging	Het
Lyrm7	T	A	11: 54,848,599	H75L	possibly damaging	Het
Map4k1	A	T	7: 28,991,036	Q351L	probably benign	Het
Mgam	T	C	6: 40,661,683	I450T	probably benign	Het
Nbeal2	A	G	9: 110,636,305	L955P	probably damaging	Het
Nlrp9c	T	C	7: 26,378,101	K752R	possibly damaging	Het
Nsmaf	A	T	4: 6,438,062	I70K	probably benign	Het
Olfr201	C	T	16: 59,268,944	C241Y	probably damaging	Het
Olfr298	A	G	7: 86,489,125	M142T	probably damaging	Het
Otud7a	A	G	7: 63,758,643	Y898C	probably damaging	Het
Pcdhb18	A	C	18: 37,490,892	D425A	probably damaging	Het
Prdm1	A	T	10: 44,439,986	L733*	probably null	Het
Prdm2	A	T	4: 143,135,583	I379N	probably damaging	Het
Ptprg	A	T	14: 12,220,596	Y436F	probably damaging	Het
Riok3	A	G	18: 12,137,306	D167G	probably damaging	Het
Rnf215	G	T	11: 4,135,451	R60L	probably damaging	Het
Sdk1	A	T	5: 141,999,950	H779L	probably benign	Het
Serpine2	A	G	1: 79,795,031	F390L	probably damaging	Het
Sh3d21	T	A	4: 126,151,726	K387*	probably null	Het
Slc27a5	T	C	7: 12,988,459		probably null	Het
Slc32a1	T	C	2: 158,614,577	L384P	probably damaging	Het
Sorcs1	T	C	19: 50,252,587	N454D	probably benign	Het
Spag8	T	C	4: 43,652,777	Y228C	possibly damaging	Het
Spc25	T	C	2: 69,200,087	I71V	probably damaging	Het
Tcte1	T	A	17: 45,535,252	F261I	probably damaging	Het
Thsd7a	T	A	6: 12,471,175	K481N	probably benign	Het
Tll2	G	T	19: 41,086,400	N908K	probably benign	Het
Tmem236	T	C	2: 14,192,280	V93A	probably benign	Het
Top2b	G	A	14: 16,408,953		probably null	Het
Topaz1	G	A	9: 122,767,011	S949N	probably benign	Het
Triobp	A	G	15: 78,973,738	T1180A	probably benign	Het
Trip11	A	C	12: 101,886,160	D548E	probably benign	Het
Trpv2	T	A	11: 62,589,826		probably null	Het
Vmn1r12	T	A	6: 57,159,555	H212Q	probably damaging	Het
Vmn2r112	A	G	17: 22,618,903	T782A	possibly damaging	Het
Vmn2r7	A	G	3: 64,716,455	V239A	possibly damaging	Het
Vmn2r80	T	A	10: 79,194,219	N626K	probably damaging	Het
Vmn2r99	A	G	17: 19,380,060	S449G	probably benign	Het
Wfikkn2	T	C	11: 94,238,107	T403A	probably benign	Het
Xirp2	A	G	2: 67,515,679	I2755V	probably benign	Het
Yjefn3	A	G	8: 69,889,079	V153A	probably benign	Het
Zfp677	C	A	17: 21,397,237	H185Q	possibly damaging	Het
Zfp947	C	T	17: 22,146,292	V134I	probably benign	Het

Other mutations in Slc13a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Slc13a2	APN	11	78400548	missense	probably damaging	1.00
IGL01604:Slc13a2	APN	11	78403395	missense	possibly damaging	0.82
IGL01679:Slc13a2	APN	11	78404711	missense	probably damaging	1.00
IGL03100:Slc13a2	APN	11	78404473	missense	probably damaging	1.00
IGL03380:Slc13a2	APN	11	78399082	missense	probably benign	0.03
deliberate	UTSW	11	78403480	critical splice acceptor site	probably benign
Familiaris	UTSW	11	78404795	missense	probably damaging	1.00
intentional	UTSW	11	78404708	missense	probably damaging	1.00
R0085:Slc13a2	UTSW	11	78406868	missense	probably damaging	0.96
R0324:Slc13a2	UTSW	11	78404524	missense	probably damaging	1.00
R0368:Slc13a2	UTSW	11	78404800	nonsense	probably null
R0440:Slc13a2	UTSW	11	78403175	missense	probably benign	0.05
R0539:Slc13a2	UTSW	11	78399138	missense	probably damaging	1.00
R1550:Slc13a2	UTSW	11	78403164	missense	probably damaging	1.00
R1909:Slc13a2	UTSW	11	78400142	missense	possibly damaging	0.90
R2166:Slc13a2	UTSW	11	78403075	missense	probably benign	0.16
R2994:Slc13a2	UTSW	11	78404737	missense	probably damaging	1.00
R2998:Slc13a2	UTSW	11	78404785	missense	probably damaging	0.99
R3418:Slc13a2	UTSW	11	78400840	missense	probably benign	0.05
R3932:Slc13a2	UTSW	11	78398400	missense	probably damaging	1.00
R4233:Slc13a2	UTSW	11	78403535	intron	probably benign
R4462:Slc13a2	UTSW	11	78404387	missense	probably benign	0.44
R5014:Slc13a2	UTSW	11	78400161	missense	possibly damaging	0.73
R5170:Slc13a2	UTSW	11	78400808	missense	probably damaging	1.00
R5484:Slc13a2	UTSW	11	78404822	splice site	probably benign
R5809:Slc13a2	UTSW	11	78397821	missense	probably damaging	1.00
R5973:Slc13a2	UTSW	11	78400532	missense	probably damaging	0.99
R6243:Slc13a2	UTSW	11	78404708	missense	probably damaging	1.00
R6263:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6275:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6276:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6279:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6280:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6300:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6305:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6314:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6673:Slc13a2	UTSW	11	78397831	missense	probably benign	0.12
R7138:Slc13a2	UTSW	11	78399124	missense	possibly damaging	0.76
R7382:Slc13a2	UTSW	11	78404795	missense	probably damaging	1.00
R7657:Slc13a2	UTSW	11	78398397	missense	probably damaging	0.99
R7791:Slc13a2	UTSW	11	78422064	critical splice donor site	probably null
R8027:Slc13a2	UTSW	11	78404756	missense	probably benign	0.00
R9091:Slc13a2	UTSW	11	78404432	missense	probably damaging	1.00
R9270:Slc13a2	UTSW	11	78404432	missense	probably damaging	1.00
R9484:Slc13a2	UTSW	11	78403407	missense	probably damaging	0.97
R9501:Slc13a2	UTSW	11	78400807	missense	probably damaging	1.00
R9783:Slc13a2	UTSW	11	78403351	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGACACGAGCATCTTCCTCTTCAC -3'
(R):5'- ACTGAACCTGAAGGCAGGACTTCC -3'

Sequencing Primer
(F):5'- CTCTTCACCGGAGAGCAC -3'
(R):5'- TTCCCAAGGAGGGCTTTGC -3'

Posted On

2014-04-13