Mutagenetix > Incidental Mutations

Incidental Mutation 'R1519:Actn1'

167312

Institutional Source

Beutler Lab

Gene Symbol

Actn1

Ensembl Gene

ENSMUSG00000015143

Gene Name

actinin, alpha 1

Synonyms

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.345) question?

Stock #

R1519 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80167547-80260371 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80205078 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 75 (E75G)

Ref Sequence

ENSEMBL: ENSMUSP00000127176 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021554
AA Change: E75G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: E75G

Domain	Start	End	E-Value	Type
CH	33	133	4.24e-23	SMART
CH	146	245	5.06e-21	SMART
Pfam:Spectrin	274	384	5.9e-17	PFAM
SPEC	397	498	1.69e-25	SMART
SPEC	512	619	1.47e-2	SMART
Pfam:Spectrin	630	733	4.7e-14	PFAM
EFh	750	778	1.73e-5	SMART
EFh	791	819	8.13e-2	SMART
efhand_Ca_insen	822	888	5.22e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167327
AA Change: E75G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: E75G

Domain	Start	End	E-Value	Type
CH	33	133	4.24e-23	SMART
CH	146	245	5.06e-21	SMART
Pfam:Spectrin	274	384	1.7e-17	PFAM
SPEC	397	498	1.69e-25	SMART
SPEC	512	619	1.47e-2	SMART
Pfam:Spectrin	630	733	8.4e-14	PFAM
EFh	750	778	1.36e0	SMART
EFh	786	814	8.13e-2	SMART
efhand_Ca_insen	817	883	5.22e-38	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218235

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218874

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220351

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	C	G	10: 100,603,528	P187R	probably damaging	Het
9230019H11Rik	A	G	10: 3,125,230		noncoding transcript	Het
9530077C05Rik	T	G	9: 22,430,375	L114R	probably benign	Het
Abhd5	T	C	9: 122,379,014		probably null	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Adam4	A	T	12: 81,420,877	N323K	possibly damaging	Het
Anks6	G	A	4: 47,027,152	R689W	probably damaging	Het
Anxa2	T	C	9: 69,485,241	I124T	probably damaging	Het
Aph1c	T	C	9: 66,833,265	T10A	probably benign	Het
Arhgap40	T	A	2: 158,546,801	W552R	probably benign	Het
Baz2b	C	T	2: 59,948,254	R754H	possibly damaging	Het
Blmh	A	G	11: 76,966,781	Y147C	probably damaging	Het
C1galt1	C	T	6: 7,866,402	L83F	probably damaging	Het
Cd163l1	G	A	7: 140,228,156	V747I	probably benign	Het
Cdh23	A	T	10: 60,379,343	Y1403N	possibly damaging	Het
Cic	A	T	7: 25,293,810		probably null	Het
Coro1b	T	A	19: 4,150,584	V200D	possibly damaging	Het
Csl	T	A	10: 99,757,955	E416V	probably damaging	Het
Cyp3a25	A	G	5: 146,001,447		probably null	Het
Dennd2d	T	A	3: 106,492,559	F266Y	probably damaging	Het
Dnah10	A	G	5: 124,760,952	E1072G	probably damaging	Het
Dnah6	T	A	6: 73,049,048	K3435N	probably damaging	Het
Dnah9	G	A	11: 65,881,761	A3715V	probably damaging	Het
Fam186a	G	A	15: 99,947,655	S236L	unknown	Het
Fam198b	A	G	3: 79,941,464	N506D	possibly damaging	Het
Frs3	A	G	17: 47,702,978	T199A	probably benign	Het
Fsd1	A	G	17: 55,993,870	N243S	probably benign	Het
Gabra5	A	C	7: 57,408,893	L369R	probably benign	Het
Gins4	A	G	8: 23,234,776	V54A	probably benign	Het
Gli1	T	C	10: 127,334,269	E339G	possibly damaging	Het
Gm12185	A	G	11: 48,907,767	V633A	probably damaging	Het
Gm8251	A	G	1: 44,056,970	V1656A	probably benign	Het
Gm8765	G	A	13: 50,700,407		probably null	Het
Gpr83	T	A	9: 14,868,197	C182S	probably null	Het
Gspt1	A	G	16: 11,220,855	V627A	probably damaging	Het
Heatr1	T	C	13: 12,412,159	C722R	probably benign	Het
Jak1	C	T	4: 101,162,922	R680Q	probably damaging	Het
Kif2c	A	G	4: 117,169,940	V287A	probably damaging	Het
Kmo	C	T	1: 175,651,618	P240L	possibly damaging	Het
Kmo	A	G	1: 175,656,802	E366G	probably damaging	Het
Lepr	A	T	4: 101,789,344	N824I	probably damaging	Het
Lyrm7	T	A	11: 54,848,599	H75L	possibly damaging	Het
Map4k1	A	T	7: 28,991,036	Q351L	probably benign	Het
Mgam	T	C	6: 40,661,683	I450T	probably benign	Het
Nbeal2	A	G	9: 110,636,305	L955P	probably damaging	Het
Nlrp9c	T	C	7: 26,378,101	K752R	possibly damaging	Het
Nsmaf	A	T	4: 6,438,062	I70K	probably benign	Het
Olfr201	C	T	16: 59,268,944	C241Y	probably damaging	Het
Olfr298	A	G	7: 86,489,125	M142T	probably damaging	Het
Otud7a	A	G	7: 63,758,643	Y898C	probably damaging	Het
Pcdhb18	A	C	18: 37,490,892	D425A	probably damaging	Het
Prdm1	A	T	10: 44,439,986	L733*	probably null	Het
Prdm2	A	T	4: 143,135,583	I379N	probably damaging	Het
Ptprg	A	T	14: 12,220,596	Y436F	probably damaging	Het
Riok3	A	G	18: 12,137,306	D167G	probably damaging	Het
Rnf215	G	T	11: 4,135,451	R60L	probably damaging	Het
Sdk1	A	T	5: 141,999,950	H779L	probably benign	Het
Serpine2	A	G	1: 79,795,031	F390L	probably damaging	Het
Sh3d21	T	A	4: 126,151,726	K387*	probably null	Het
Slc13a2	T	C	11: 78,397,746	Y568C	possibly damaging	Het
Slc27a5	T	C	7: 12,988,459		probably null	Het
Slc32a1	T	C	2: 158,614,577	L384P	probably damaging	Het
Sorcs1	T	C	19: 50,252,587	N454D	probably benign	Het
Spag8	T	C	4: 43,652,777	Y228C	possibly damaging	Het
Spc25	T	C	2: 69,200,087	I71V	probably damaging	Het
Tcte1	T	A	17: 45,535,252	F261I	probably damaging	Het
Thsd7a	T	A	6: 12,471,175	K481N	probably benign	Het
Tll2	G	T	19: 41,086,400	N908K	probably benign	Het
Tmem236	T	C	2: 14,192,280	V93A	probably benign	Het
Top2b	G	A	14: 16,408,953		probably null	Het
Topaz1	G	A	9: 122,767,011	S949N	probably benign	Het
Triobp	A	G	15: 78,973,738	T1180A	probably benign	Het
Trip11	A	C	12: 101,886,160	D548E	probably benign	Het
Trpv2	T	A	11: 62,589,826		probably null	Het
Vmn1r12	T	A	6: 57,159,555	H212Q	probably damaging	Het
Vmn2r112	A	G	17: 22,618,903	T782A	possibly damaging	Het
Vmn2r7	A	G	3: 64,716,455	V239A	possibly damaging	Het
Vmn2r80	T	A	10: 79,194,219	N626K	probably damaging	Het
Vmn2r99	A	G	17: 19,380,060	S449G	probably benign	Het
Wfikkn2	T	C	11: 94,238,107	T403A	probably benign	Het
Xirp2	A	G	2: 67,515,679	I2755V	probably benign	Het
Yjefn3	A	G	8: 69,889,079	V153A	probably benign	Het
Zfp677	C	A	17: 21,397,237	H185Q	possibly damaging	Het
Zfp947	C	T	17: 22,146,292	V134I	probably benign	Het

Other mutations in Actn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01090:Actn1	APN	12	80199072	splice site	probably null
IGL01152:Actn1	APN	12	80199046	missense	probably damaging	1.00
IGL01386:Actn1	APN	12	80193672	missense	probably benign	0.03
IGL01890:Actn1	APN	12	80184868	missense	probably damaging	0.99
IGL01937:Actn1	APN	12	80171763	missense	probably benign	0.03
IGL02142:Actn1	APN	12	80176155	critical splice donor site	probably null
IGL02191:Actn1	APN	12	80174109	missense	probably benign
IGL02217:Actn1	APN	12	80174094	nonsense	probably null
IGL02230:Actn1	APN	12	80171830	missense	probably benign	0.02
IGL03163:Actn1	APN	12	80181417	missense	probably benign	0.33
IGL03401:Actn1	APN	12	80168967	nonsense	probably null
R0538:Actn1	UTSW	12	80260100	unclassified	probably benign
R0546:Actn1	UTSW	12	80178434	missense	probably benign
R0583:Actn1	UTSW	12	80199029	missense	probably damaging	1.00
R0606:Actn1	UTSW	12	80174647	splice site	probably benign
R1340:Actn1	UTSW	12	80173144	critical splice acceptor site	probably null
R1572:Actn1	UTSW	12	80172957	splice site	probably benign
R1619:Actn1	UTSW	12	80173022	missense	probably damaging	1.00
R1677:Actn1	UTSW	12	80260032	missense	probably benign	0.02
R1994:Actn1	UTSW	12	80204971	nonsense	probably null
R2102:Actn1	UTSW	12	80183517	missense	probably benign	0.38
R2157:Actn1	UTSW	12	80173117	missense	probably benign	0.04
R2191:Actn1	UTSW	12	80171802	nonsense	probably null
R2519:Actn1	UTSW	12	80192389	missense	probably damaging	1.00
R2988:Actn1	UTSW	12	80192388	missense	possibly damaging	0.78
R4024:Actn1	UTSW	12	80168477	missense	probably damaging	1.00
R4589:Actn1	UTSW	12	80171799	missense	possibly damaging	0.53
R4907:Actn1	UTSW	12	80181414	missense	probably damaging	0.99
R4936:Actn1	UTSW	12	80172998	missense	probably benign	0.09
R4966:Actn1	UTSW	12	80173130	missense	probably benign	0.01
R4972:Actn1	UTSW	12	80173039	missense	probably benign	0.35
R5395:Actn1	UTSW	12	80170703	missense	probably benign
R5460:Actn1	UTSW	12	80183568	missense	probably benign	0.00
R5467:Actn1	UTSW	12	80176217	missense	possibly damaging	0.86
R5470:Actn1	UTSW	12	80168941	missense	probably damaging	0.99
R5661:Actn1	UTSW	12	80184844	missense	probably benign	0.09
R5985:Actn1	UTSW	12	80168395	missense	probably damaging	1.00
R6020:Actn1	UTSW	12	80174455	splice site	probably null
R6042:Actn1	UTSW	12	80177249	missense	probably benign	0.04
R6389:Actn1	UTSW	12	80174522	missense	probably benign
R6499:Actn1	UTSW	12	80168417	missense	possibly damaging	0.59
R6709:Actn1	UTSW	12	80193644	missense	probably damaging	1.00
R7016:Actn1	UTSW	12	80172968	missense	possibly damaging	0.94
R7116:Actn1	UTSW	12	80204977	missense	probably damaging	1.00
R7173:Actn1	UTSW	12	80177259	missense	possibly damaging	0.70
R7183:Actn1	UTSW	12	80168932	missense	possibly damaging	0.87
R7291:Actn1	UTSW	12	80174085	missense	probably benign	0.00
R7361:Actn1	UTSW	12	80193715	missense	probably benign	0.01
R7452:Actn1	UTSW	12	80183602	missense	probably benign	0.12
R7698:Actn1	UTSW	12	80174537	missense	probably benign	0.00
R7701:Actn1	UTSW	12	80174554	missense	possibly damaging	0.88
R8000:Actn1	UTSW	12	80199008	missense	probably damaging	1.00
R8171:Actn1	UTSW	12	80196393	critical splice donor site	probably null
R8287:Actn1	UTSW	12	80174078	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TAAGAATGCTGCTTTGGCCCTCCC -3'
(R):5'- GCCTGCCTAGATGACAACTGCAAAC -3'

Sequencing Primer
(F):5'- tccaggatagctagggctac -3'
(R):5'- AGATGACAACTGCAAACATCTG -3'

Posted On

2014-04-13