Incidental Mutation 'R1519:Actn1'
ID167312
Institutional Source Beutler Lab
Gene Symbol Actn1
Ensembl Gene ENSMUSG00000015143
Gene Nameactinin, alpha 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R1519 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location80167547-80260371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80205078 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 75 (E75G)
Ref Sequence ENSEMBL: ENSMUSP00000127176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]
Predicted Effect probably damaging
Transcript: ENSMUST00000021554
AA Change: E75G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: E75G

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 5.9e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 4.7e-14 PFAM
EFh 750 778 1.73e-5 SMART
EFh 791 819 8.13e-2 SMART
efhand_Ca_insen 822 888 5.22e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167327
AA Change: E75G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: E75G

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 1.7e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 8.4e-14 PFAM
EFh 750 778 1.36e0 SMART
EFh 786 814 8.13e-2 SMART
efhand_Ca_insen 817 883 5.22e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220351
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
9230019H11Rik A G 10: 3,125,230 noncoding transcript Het
9530077C05Rik T G 9: 22,430,375 L114R probably benign Het
Abhd5 T C 9: 122,379,014 probably null Het
Acadvl A G 11: 70,014,791 probably null Het
Adam4 A T 12: 81,420,877 N323K possibly damaging Het
Anks6 G A 4: 47,027,152 R689W probably damaging Het
Anxa2 T C 9: 69,485,241 I124T probably damaging Het
Aph1c T C 9: 66,833,265 T10A probably benign Het
Arhgap40 T A 2: 158,546,801 W552R probably benign Het
Baz2b C T 2: 59,948,254 R754H possibly damaging Het
Blmh A G 11: 76,966,781 Y147C probably damaging Het
C1galt1 C T 6: 7,866,402 L83F probably damaging Het
Cd163l1 G A 7: 140,228,156 V747I probably benign Het
Cdh23 A T 10: 60,379,343 Y1403N possibly damaging Het
Cic A T 7: 25,293,810 probably null Het
Coro1b T A 19: 4,150,584 V200D possibly damaging Het
Csl T A 10: 99,757,955 E416V probably damaging Het
Cyp3a25 A G 5: 146,001,447 probably null Het
Dennd2d T A 3: 106,492,559 F266Y probably damaging Het
Dnah10 A G 5: 124,760,952 E1072G probably damaging Het
Dnah6 T A 6: 73,049,048 K3435N probably damaging Het
Dnah9 G A 11: 65,881,761 A3715V probably damaging Het
Fam186a G A 15: 99,947,655 S236L unknown Het
Fam198b A G 3: 79,941,464 N506D possibly damaging Het
Frs3 A G 17: 47,702,978 T199A probably benign Het
Fsd1 A G 17: 55,993,870 N243S probably benign Het
Gabra5 A C 7: 57,408,893 L369R probably benign Het
Gins4 A G 8: 23,234,776 V54A probably benign Het
Gli1 T C 10: 127,334,269 E339G possibly damaging Het
Gm12185 A G 11: 48,907,767 V633A probably damaging Het
Gm8251 A G 1: 44,056,970 V1656A probably benign Het
Gm8765 G A 13: 50,700,407 probably null Het
Gpr83 T A 9: 14,868,197 C182S probably null Het
Gspt1 A G 16: 11,220,855 V627A probably damaging Het
Heatr1 T C 13: 12,412,159 C722R probably benign Het
Jak1 C T 4: 101,162,922 R680Q probably damaging Het
Kif2c A G 4: 117,169,940 V287A probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Kmo A G 1: 175,656,802 E366G probably damaging Het
Lepr A T 4: 101,789,344 N824I probably damaging Het
Lyrm7 T A 11: 54,848,599 H75L possibly damaging Het
Map4k1 A T 7: 28,991,036 Q351L probably benign Het
Mgam T C 6: 40,661,683 I450T probably benign Het
Nbeal2 A G 9: 110,636,305 L955P probably damaging Het
Nlrp9c T C 7: 26,378,101 K752R possibly damaging Het
Nsmaf A T 4: 6,438,062 I70K probably benign Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr298 A G 7: 86,489,125 M142T probably damaging Het
Otud7a A G 7: 63,758,643 Y898C probably damaging Het
Pcdhb18 A C 18: 37,490,892 D425A probably damaging Het
Prdm1 A T 10: 44,439,986 L733* probably null Het
Prdm2 A T 4: 143,135,583 I379N probably damaging Het
Ptprg A T 14: 12,220,596 Y436F probably damaging Het
Riok3 A G 18: 12,137,306 D167G probably damaging Het
Rnf215 G T 11: 4,135,451 R60L probably damaging Het
Sdk1 A T 5: 141,999,950 H779L probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sh3d21 T A 4: 126,151,726 K387* probably null Het
Slc13a2 T C 11: 78,397,746 Y568C possibly damaging Het
Slc27a5 T C 7: 12,988,459 probably null Het
Slc32a1 T C 2: 158,614,577 L384P probably damaging Het
Sorcs1 T C 19: 50,252,587 N454D probably benign Het
Spag8 T C 4: 43,652,777 Y228C possibly damaging Het
Spc25 T C 2: 69,200,087 I71V probably damaging Het
Tcte1 T A 17: 45,535,252 F261I probably damaging Het
Thsd7a T A 6: 12,471,175 K481N probably benign Het
Tll2 G T 19: 41,086,400 N908K probably benign Het
Tmem236 T C 2: 14,192,280 V93A probably benign Het
Top2b G A 14: 16,408,953 probably null Het
Topaz1 G A 9: 122,767,011 S949N probably benign Het
Triobp A G 15: 78,973,738 T1180A probably benign Het
Trip11 A C 12: 101,886,160 D548E probably benign Het
Trpv2 T A 11: 62,589,826 probably null Het
Vmn1r12 T A 6: 57,159,555 H212Q probably damaging Het
Vmn2r112 A G 17: 22,618,903 T782A possibly damaging Het
Vmn2r7 A G 3: 64,716,455 V239A possibly damaging Het
Vmn2r80 T A 10: 79,194,219 N626K probably damaging Het
Vmn2r99 A G 17: 19,380,060 S449G probably benign Het
Wfikkn2 T C 11: 94,238,107 T403A probably benign Het
Xirp2 A G 2: 67,515,679 I2755V probably benign Het
Yjefn3 A G 8: 69,889,079 V153A probably benign Het
Zfp677 C A 17: 21,397,237 H185Q possibly damaging Het
Zfp947 C T 17: 22,146,292 V134I probably benign Het
Other mutations in Actn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Actn1 APN 12 80199072 splice site probably null
IGL01152:Actn1 APN 12 80199046 missense probably damaging 1.00
IGL01386:Actn1 APN 12 80193672 missense probably benign 0.03
IGL01890:Actn1 APN 12 80184868 missense probably damaging 0.99
IGL01937:Actn1 APN 12 80171763 missense probably benign 0.03
IGL02142:Actn1 APN 12 80176155 critical splice donor site probably null
IGL02191:Actn1 APN 12 80174109 missense probably benign
IGL02217:Actn1 APN 12 80174094 nonsense probably null
IGL02230:Actn1 APN 12 80171830 missense probably benign 0.02
IGL03163:Actn1 APN 12 80181417 missense probably benign 0.33
IGL03401:Actn1 APN 12 80168967 nonsense probably null
R0538:Actn1 UTSW 12 80260100 unclassified probably benign
R0546:Actn1 UTSW 12 80178434 missense probably benign
R0583:Actn1 UTSW 12 80199029 missense probably damaging 1.00
R0606:Actn1 UTSW 12 80174647 splice site probably benign
R1340:Actn1 UTSW 12 80173144 critical splice acceptor site probably null
R1572:Actn1 UTSW 12 80172957 splice site probably benign
R1619:Actn1 UTSW 12 80173022 missense probably damaging 1.00
R1677:Actn1 UTSW 12 80260032 missense probably benign 0.02
R1994:Actn1 UTSW 12 80204971 nonsense probably null
R2102:Actn1 UTSW 12 80183517 missense probably benign 0.38
R2157:Actn1 UTSW 12 80173117 missense probably benign 0.04
R2191:Actn1 UTSW 12 80171802 nonsense probably null
R2519:Actn1 UTSW 12 80192389 missense probably damaging 1.00
R2988:Actn1 UTSW 12 80192388 missense possibly damaging 0.78
R4024:Actn1 UTSW 12 80168477 missense probably damaging 1.00
R4589:Actn1 UTSW 12 80171799 missense possibly damaging 0.53
R4907:Actn1 UTSW 12 80181414 missense probably damaging 0.99
R4936:Actn1 UTSW 12 80172998 missense probably benign 0.09
R4966:Actn1 UTSW 12 80173130 missense probably benign 0.01
R4972:Actn1 UTSW 12 80173039 missense probably benign 0.35
R5395:Actn1 UTSW 12 80170703 missense probably benign
R5460:Actn1 UTSW 12 80183568 missense probably benign 0.00
R5467:Actn1 UTSW 12 80176217 missense possibly damaging 0.86
R5470:Actn1 UTSW 12 80168941 missense probably damaging 0.99
R5661:Actn1 UTSW 12 80184844 missense probably benign 0.09
R5985:Actn1 UTSW 12 80168395 missense probably damaging 1.00
R6020:Actn1 UTSW 12 80174455 splice site probably null
R6042:Actn1 UTSW 12 80177249 missense probably benign 0.04
R6389:Actn1 UTSW 12 80174522 missense probably benign
R6499:Actn1 UTSW 12 80168417 missense possibly damaging 0.59
R6709:Actn1 UTSW 12 80193644 missense probably damaging 1.00
R7016:Actn1 UTSW 12 80172968 missense possibly damaging 0.94
R7116:Actn1 UTSW 12 80204977 missense probably damaging 1.00
R7173:Actn1 UTSW 12 80177259 missense possibly damaging 0.70
R7183:Actn1 UTSW 12 80168932 missense possibly damaging 0.87
R7291:Actn1 UTSW 12 80174085 missense probably benign 0.00
R7361:Actn1 UTSW 12 80193715 missense probably benign 0.01
R7452:Actn1 UTSW 12 80183602 missense probably benign 0.12
R7698:Actn1 UTSW 12 80174537 missense probably benign 0.00
R7701:Actn1 UTSW 12 80174554 missense possibly damaging 0.88
R8000:Actn1 UTSW 12 80199008 missense probably damaging 1.00
R8171:Actn1 UTSW 12 80196393 critical splice donor site probably null
R8287:Actn1 UTSW 12 80174078 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAAGAATGCTGCTTTGGCCCTCCC -3'
(R):5'- GCCTGCCTAGATGACAACTGCAAAC -3'

Sequencing Primer
(F):5'- tccaggatagctagggctac -3'
(R):5'- AGATGACAACTGCAAACATCTG -3'
Posted On2014-04-13