Incidental Mutation 'R1519:Top2b'
ID 167318
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Name topoisomerase (DNA) II beta
Synonyms D230016L12Rik, Top-2
Accession Numbers
Essential gene? Probably essential (E-score: 0.922) question?
Stock # R1519 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 16365179-16435462 bp(+) (GRCm38)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 16408953 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
AlphaFold Q64511
Predicted Effect probably null
Transcript: ENSMUST00000017629
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159302
SMART Domains Protein: ENSMUSP00000123789
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 1 177 4.06e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160501
SMART Domains Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 2 222 3.97e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161693
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
9230019H11Rik A G 10: 3,125,230 noncoding transcript Het
9530077C05Rik T G 9: 22,430,375 L114R probably benign Het
Abhd5 T C 9: 122,379,014 probably null Het
Acadvl A G 11: 70,014,791 probably null Het
Actn1 T C 12: 80,205,078 E75G probably damaging Het
Adam4 A T 12: 81,420,877 N323K possibly damaging Het
Anks6 G A 4: 47,027,152 R689W probably damaging Het
Anxa2 T C 9: 69,485,241 I124T probably damaging Het
Aph1c T C 9: 66,833,265 T10A probably benign Het
Arhgap40 T A 2: 158,546,801 W552R probably benign Het
Baz2b C T 2: 59,948,254 R754H possibly damaging Het
Blmh A G 11: 76,966,781 Y147C probably damaging Het
C1galt1 C T 6: 7,866,402 L83F probably damaging Het
Cd163l1 G A 7: 140,228,156 V747I probably benign Het
Cdh23 A T 10: 60,379,343 Y1403N possibly damaging Het
Cic A T 7: 25,293,810 probably null Het
Coro1b T A 19: 4,150,584 V200D possibly damaging Het
Csl T A 10: 99,757,955 E416V probably damaging Het
Cyp3a25 A G 5: 146,001,447 probably null Het
Dennd2d T A 3: 106,492,559 F266Y probably damaging Het
Dnah10 A G 5: 124,760,952 E1072G probably damaging Het
Dnah6 T A 6: 73,049,048 K3435N probably damaging Het
Dnah9 G A 11: 65,881,761 A3715V probably damaging Het
Fam186a G A 15: 99,947,655 S236L unknown Het
Fam198b A G 3: 79,941,464 N506D possibly damaging Het
Frs3 A G 17: 47,702,978 T199A probably benign Het
Fsd1 A G 17: 55,993,870 N243S probably benign Het
Gabra5 A C 7: 57,408,893 L369R probably benign Het
Gins4 A G 8: 23,234,776 V54A probably benign Het
Gli1 T C 10: 127,334,269 E339G possibly damaging Het
Gm12185 A G 11: 48,907,767 V633A probably damaging Het
Gm8251 A G 1: 44,056,970 V1656A probably benign Het
Gm8765 G A 13: 50,700,407 probably null Het
Gpr83 T A 9: 14,868,197 C182S probably null Het
Gspt1 A G 16: 11,220,855 V627A probably damaging Het
Heatr1 T C 13: 12,412,159 C722R probably benign Het
Jak1 C T 4: 101,162,922 R680Q probably damaging Het
Kif2c A G 4: 117,169,940 V287A probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Kmo A G 1: 175,656,802 E366G probably damaging Het
Lepr A T 4: 101,789,344 N824I probably damaging Het
Lyrm7 T A 11: 54,848,599 H75L possibly damaging Het
Map4k1 A T 7: 28,991,036 Q351L probably benign Het
Mgam T C 6: 40,661,683 I450T probably benign Het
Nbeal2 A G 9: 110,636,305 L955P probably damaging Het
Nlrp9c T C 7: 26,378,101 K752R possibly damaging Het
Nsmaf A T 4: 6,438,062 I70K probably benign Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr298 A G 7: 86,489,125 M142T probably damaging Het
Otud7a A G 7: 63,758,643 Y898C probably damaging Het
Pcdhb18 A C 18: 37,490,892 D425A probably damaging Het
Prdm1 A T 10: 44,439,986 L733* probably null Het
Prdm2 A T 4: 143,135,583 I379N probably damaging Het
Ptprg A T 14: 12,220,596 Y436F probably damaging Het
Riok3 A G 18: 12,137,306 D167G probably damaging Het
Rnf215 G T 11: 4,135,451 R60L probably damaging Het
Sdk1 A T 5: 141,999,950 H779L probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sh3d21 T A 4: 126,151,726 K387* probably null Het
Slc13a2 T C 11: 78,397,746 Y568C possibly damaging Het
Slc27a5 T C 7: 12,988,459 probably null Het
Slc32a1 T C 2: 158,614,577 L384P probably damaging Het
Sorcs1 T C 19: 50,252,587 N454D probably benign Het
Spag8 T C 4: 43,652,777 Y228C possibly damaging Het
Spc25 T C 2: 69,200,087 I71V probably damaging Het
Tcte1 T A 17: 45,535,252 F261I probably damaging Het
Thsd7a T A 6: 12,471,175 K481N probably benign Het
Tll2 G T 19: 41,086,400 N908K probably benign Het
Tmem236 T C 2: 14,192,280 V93A probably benign Het
Topaz1 G A 9: 122,767,011 S949N probably benign Het
Triobp A G 15: 78,973,738 T1180A probably benign Het
Trip11 A C 12: 101,886,160 D548E probably benign Het
Trpv2 T A 11: 62,589,826 probably null Het
Vmn1r12 T A 6: 57,159,555 H212Q probably damaging Het
Vmn2r112 A G 17: 22,618,903 T782A possibly damaging Het
Vmn2r7 A G 3: 64,716,455 V239A possibly damaging Het
Vmn2r80 T A 10: 79,194,219 N626K probably damaging Het
Vmn2r99 A G 17: 19,380,060 S449G probably benign Het
Wfikkn2 T C 11: 94,238,107 T403A probably benign Het
Xirp2 A G 2: 67,515,679 I2755V probably benign Het
Yjefn3 A G 8: 69,889,079 V153A probably benign Het
Zfp677 C A 17: 21,397,237 H185Q possibly damaging Het
Zfp947 C T 17: 22,146,292 V134I probably benign Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
R7594:Top2b UTSW 14 16428587 missense probably benign
R7670:Top2b UTSW 14 16416620 missense possibly damaging 0.61
R7894:Top2b UTSW 14 16413081 missense possibly damaging 0.68
R8031:Top2b UTSW 14 16412986 missense probably damaging 0.98
R8150:Top2b UTSW 14 16393291 missense probably damaging 0.99
R8214:Top2b UTSW 14 16383177 missense probably damaging 1.00
R8299:Top2b UTSW 14 16386123 missense possibly damaging 0.68
R8977:Top2b UTSW 14 16393239 missense probably benign 0.36
R9562:Top2b UTSW 14 16365718 missense probably benign 0.09
R9565:Top2b UTSW 14 16365718 missense probably benign 0.09
R9798:Top2b UTSW 14 16389845 missense probably damaging 1.00
X0028:Top2b UTSW 14 16384499 nonsense probably null
Z1176:Top2b UTSW 14 16395434 missense probably damaging 1.00
Z1177:Top2b UTSW 14 16416953 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATCAGAGAGTGTAGGTTGCATGGC -3'
(R):5'- TCCAAACTGACCAATGGGCTGAAG -3'

Sequencing Primer
(F):5'- AGGTTGCATGGCCTATCAGAG -3'
(R):5'- TTACTGCCCACAAAATTCTGAG -3'
Posted On 2014-04-13