Incidental Mutation 'R1519:Gspt1'
Institutional Source Beutler Lab
Gene Symbol Gspt1
Ensembl Gene ENSMUSG00000062203
Gene NameG1 to S phase transition 1
SynonymsGst-1, G1st, Gst-1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R1519 (G1)
Quality Score225
Status Not validated
Chromosomal Location11219292-11254325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11220855 bp
Amino Acid Change Valine to Alanine at position 627 (V627A)
Ref Sequence ENSEMBL: ENSMUSP00000130583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080030] [ENSMUST00000167571]
Predicted Effect probably damaging
Transcript: ENSMUST00000080030
AA Change: V628A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078940
Gene: ENSMUSG00000062203
AA Change: V628A

low complexity region 4 20 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
Pfam:PAM2 64 81 4.3e-8 PFAM
low complexity region 101 116 N/A INTRINSIC
low complexity region 151 193 N/A INTRINSIC
Pfam:GTP_EFTU 209 482 3.1e-47 PFAM
Pfam:GTP_EFTU_D2 451 518 1.2e-8 PFAM
Pfam:GTP_EFTU_D3 524 632 7.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164098
Predicted Effect unknown
Transcript: ENSMUST00000167025
AA Change: V91A
SMART Domains Protein: ENSMUSP00000130959
Gene: ENSMUSG00000062203
AA Change: V91A

Pfam:GTP_EFTU_D3 18 96 2.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167571
AA Change: V627A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130583
Gene: ENSMUSG00000062203
AA Change: V627A

low complexity region 4 20 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
Pfam:PAM2 64 81 7.1e-8 PFAM
low complexity region 101 116 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
Pfam:GTP_EFTU 208 476 4.3e-49 PFAM
Pfam:GTP_EFTU_D2 450 517 1.3e-7 PFAM
Pfam:GTP_EFTU_D3 523 631 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230245
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
9230019H11Rik A G 10: 3,125,230 noncoding transcript Het
9530077C05Rik T G 9: 22,430,375 L114R probably benign Het
Abhd5 T C 9: 122,379,014 probably null Het
Acadvl A G 11: 70,014,791 probably null Het
Actn1 T C 12: 80,205,078 E75G probably damaging Het
Adam4 A T 12: 81,420,877 N323K possibly damaging Het
Anks6 G A 4: 47,027,152 R689W probably damaging Het
Anxa2 T C 9: 69,485,241 I124T probably damaging Het
Aph1c T C 9: 66,833,265 T10A probably benign Het
Arhgap40 T A 2: 158,546,801 W552R probably benign Het
Baz2b C T 2: 59,948,254 R754H possibly damaging Het
Blmh A G 11: 76,966,781 Y147C probably damaging Het
C1galt1 C T 6: 7,866,402 L83F probably damaging Het
Cd163l1 G A 7: 140,228,156 V747I probably benign Het
Cdh23 A T 10: 60,379,343 Y1403N possibly damaging Het
Cic A T 7: 25,293,810 probably null Het
Coro1b T A 19: 4,150,584 V200D possibly damaging Het
Csl T A 10: 99,757,955 E416V probably damaging Het
Cyp3a25 A G 5: 146,001,447 probably null Het
Dennd2d T A 3: 106,492,559 F266Y probably damaging Het
Dnah10 A G 5: 124,760,952 E1072G probably damaging Het
Dnah6 T A 6: 73,049,048 K3435N probably damaging Het
Dnah9 G A 11: 65,881,761 A3715V probably damaging Het
Fam186a G A 15: 99,947,655 S236L unknown Het
Fam198b A G 3: 79,941,464 N506D possibly damaging Het
Frs3 A G 17: 47,702,978 T199A probably benign Het
Fsd1 A G 17: 55,993,870 N243S probably benign Het
Gabra5 A C 7: 57,408,893 L369R probably benign Het
Gins4 A G 8: 23,234,776 V54A probably benign Het
Gli1 T C 10: 127,334,269 E339G possibly damaging Het
Gm12185 A G 11: 48,907,767 V633A probably damaging Het
Gm8251 A G 1: 44,056,970 V1656A probably benign Het
Gm8765 G A 13: 50,700,407 probably null Het
Gpr83 T A 9: 14,868,197 C182S probably null Het
Heatr1 T C 13: 12,412,159 C722R probably benign Het
Jak1 C T 4: 101,162,922 R680Q probably damaging Het
Kif2c A G 4: 117,169,940 V287A probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Kmo A G 1: 175,656,802 E366G probably damaging Het
Lepr A T 4: 101,789,344 N824I probably damaging Het
Lyrm7 T A 11: 54,848,599 H75L possibly damaging Het
Map4k1 A T 7: 28,991,036 Q351L probably benign Het
Mgam T C 6: 40,661,683 I450T probably benign Het
Nbeal2 A G 9: 110,636,305 L955P probably damaging Het
Nlrp9c T C 7: 26,378,101 K752R possibly damaging Het
Nsmaf A T 4: 6,438,062 I70K probably benign Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr298 A G 7: 86,489,125 M142T probably damaging Het
Otud7a A G 7: 63,758,643 Y898C probably damaging Het
Pcdhb18 A C 18: 37,490,892 D425A probably damaging Het
Prdm1 A T 10: 44,439,986 L733* probably null Het
Prdm2 A T 4: 143,135,583 I379N probably damaging Het
Ptprg A T 14: 12,220,596 Y436F probably damaging Het
Riok3 A G 18: 12,137,306 D167G probably damaging Het
Rnf215 G T 11: 4,135,451 R60L probably damaging Het
Sdk1 A T 5: 141,999,950 H779L probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sh3d21 T A 4: 126,151,726 K387* probably null Het
Slc13a2 T C 11: 78,397,746 Y568C possibly damaging Het
Slc27a5 T C 7: 12,988,459 probably null Het
Slc32a1 T C 2: 158,614,577 L384P probably damaging Het
Sorcs1 T C 19: 50,252,587 N454D probably benign Het
Spag8 T C 4: 43,652,777 Y228C possibly damaging Het
Spc25 T C 2: 69,200,087 I71V probably damaging Het
Tcte1 T A 17: 45,535,252 F261I probably damaging Het
Thsd7a T A 6: 12,471,175 K481N probably benign Het
Tll2 G T 19: 41,086,400 N908K probably benign Het
Tmem236 T C 2: 14,192,280 V93A probably benign Het
Top2b G A 14: 16,408,953 probably null Het
Topaz1 G A 9: 122,767,011 S949N probably benign Het
Triobp A G 15: 78,973,738 T1180A probably benign Het
Trip11 A C 12: 101,886,160 D548E probably benign Het
Trpv2 T A 11: 62,589,826 probably null Het
Vmn1r12 T A 6: 57,159,555 H212Q probably damaging Het
Vmn2r112 A G 17: 22,618,903 T782A possibly damaging Het
Vmn2r7 A G 3: 64,716,455 V239A possibly damaging Het
Vmn2r80 T A 10: 79,194,219 N626K probably damaging Het
Vmn2r99 A G 17: 19,380,060 S449G probably benign Het
Wfikkn2 T C 11: 94,238,107 T403A probably benign Het
Xirp2 A G 2: 67,515,679 I2755V probably benign Het
Yjefn3 A G 8: 69,889,079 V153A probably benign Het
Zfp677 C A 17: 21,397,237 H185Q possibly damaging Het
Zfp947 C T 17: 22,146,292 V134I probably benign Het
Other mutations in Gspt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Gspt1 APN 16 11222612 missense probably damaging 0.99
IGL00902:Gspt1 APN 16 11232579 missense probably damaging 1.00
IGL00983:Gspt1 APN 16 11230997 splice site probably benign
IGL01775:Gspt1 APN 16 11223295 missense possibly damaging 0.92
IGL02079:Gspt1 APN 16 11240829 missense probably benign 0.17
IGL02122:Gspt1 APN 16 11229216 missense probably damaging 1.00
IGL02525:Gspt1 APN 16 11230990 missense probably damaging 1.00
IGL03092:Gspt1 APN 16 11238899 missense probably benign 0.11
goliad UTSW 16 11224542 missense probably benign 0.04
R0835:Gspt1 UTSW 16 11238938 missense probably benign
R3410:Gspt1 UTSW 16 11229245 missense probably damaging 1.00
R4834:Gspt1 UTSW 16 11222717 missense probably damaging 1.00
R4866:Gspt1 UTSW 16 11222665 missense possibly damaging 0.69
R5121:Gspt1 UTSW 16 11223301 missense probably damaging 0.99
R5408:Gspt1 UTSW 16 11253855 missense probably benign
R5410:Gspt1 UTSW 16 11230510 missense probably benign 0.00
R5517:Gspt1 UTSW 16 11253979 missense unknown
R5704:Gspt1 UTSW 16 11228193 missense possibly damaging 0.89
R6224:Gspt1 UTSW 16 11224542 missense probably benign 0.04
R6317:Gspt1 UTSW 16 11223208 splice site probably null
R7069:Gspt1 UTSW 16 11222661 missense probably damaging 1.00
R7151:Gspt1 UTSW 16 11253828 missense probably benign 0.05
R7317:Gspt1 UTSW 16 11222657 missense probably benign 0.01
R8137:Gspt1 UTSW 16 11240668 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gccatgttgttgaatgtgctg -3'
Posted On2014-04-13