Incidental Mutation 'R1520:Zap70'
ID167336
Institutional Source Beutler Lab
Gene Symbol Zap70
Ensembl Gene ENSMUSG00000026117
Gene Namezeta-chain (TCR) associated protein kinase
SynonymsZAP-70, TZK, Srk
MMRRC Submission 039564-MU
Accession Numbers

Genbank: NM_009539; MGI: 99613

 

Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R1520 (G1)
Quality Score137
Status Not validated
Chromosome1
Chromosomal Location36761798-36782818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36770955 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 49 (S49P)
Ref Sequence ENSEMBL: ENSMUSP00000027291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027291] [ENSMUST00000185871]
Predicted Effect probably damaging
Transcript: ENSMUST00000027291
AA Change: S49P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: S49P

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185871
AA Change: S49P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139990
Gene: ENSMUSG00000026117
AA Change: S49P

DomainStartEndE-ValueType
SH2 8 85 1.9e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186624
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,297 Y410* probably null Het
1810011H11Rik A T 14: 32,805,126 probably benign Het
Abca7 A G 10: 80,008,830 N1491S possibly damaging Het
Abcb1b G A 5: 8,814,768 A249T probably damaging Het
Acacb A G 5: 114,201,940 D804G possibly damaging Het
Agpat3 A T 10: 78,288,023 M1K probably null Het
Akr1c12 A C 13: 4,276,299 I61R probably damaging Het
Antxr2 G A 5: 97,960,692 A320V probably benign Het
Arhgef1 A G 7: 24,919,704 R454G probably damaging Het
C1ql4 T C 15: 99,087,667 H21R probably benign Het
Celsr3 T C 9: 108,848,658 S3029P probably damaging Het
Chaf1a T C 17: 56,047,302 C191R unknown Het
Corin A C 5: 72,330,895 C627G probably damaging Het
Cyp3a11 T C 5: 145,862,453 Y308C probably damaging Het
Cyp4a32 A G 4: 115,614,652 N420S probably damaging Het
Eftud2 A G 11: 102,839,440 S889P probably damaging Het
Eng A G 2: 32,672,941 H267R probably benign Het
Ep400 A G 5: 110,691,778 probably benign Het
Fmo9 G T 1: 166,667,455 H292Q probably benign Het
Frmpd4 T C X: 167,492,953 S373G probably damaging Het
Fsip2 T A 2: 82,980,714 I2459K possibly damaging Het
Gbp5 A T 3: 142,508,014 H523L probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gpr65 T C 12: 98,275,175 V29A probably benign Het
Igkv7-33 T A 6: 70,059,148 probably benign Het
Iqcc G A 4: 129,616,969 T251I possibly damaging Het
Jund A G 8: 70,699,274 T73A probably benign Het
Kif14 A G 1: 136,503,324 D1153G probably benign Het
Mcm8 T C 2: 132,839,455 V617A probably benign Het
Mdga1 A G 17: 29,846,519 F646L probably benign Het
Morc3 A G 16: 93,844,241 K54E probably damaging Het
Mutyh T C 4: 116,817,552 L357P probably damaging Het
Mylk4 T C 13: 32,712,838 probably null Het
Olfr1287 G A 2: 111,449,274 V45I probably benign Het
Osbpl3 T A 6: 50,346,431 D224V possibly damaging Het
Parp4 T C 14: 56,598,406 I469T probably damaging Het
Pkd1l2 A G 8: 117,046,159 V1043A probably benign Het
Plod3 A G 5: 136,991,311 N460S probably damaging Het
Preb A G 5: 30,958,524 F192L probably benign Het
Prkra T C 2: 76,639,278 T146A possibly damaging Het
Rag2 T C 2: 101,630,131 I262T probably damaging Het
Rgr A G 14: 37,044,715 W125R probably damaging Het
Rit1 T A 3: 88,729,313 F211I probably benign Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Serinc2 C T 4: 130,260,750 V234I probably benign Het
Srp54b T C 12: 55,257,569 M434T possibly damaging Het
Srrt C A 5: 137,298,766 R69L probably damaging Het
Sv2b A G 7: 75,157,329 L191P probably damaging Het
Tcf12 C A 9: 71,883,106 probably null Het
Tmem87b T C 2: 128,839,256 probably null Het
Ttn T C 2: 76,817,048 E11031G possibly damaging Het
Uaca A T 9: 60,871,381 T1017S probably benign Het
Urb1 C A 16: 90,774,745 V1059L probably benign Het
V1rd19 G A 7: 24,003,198 A30T probably damaging Het
Vldlr C T 19: 27,240,543 L91F probably damaging Het
Vldlr G T 19: 27,247,066 A770S possibly damaging Het
Vmn2r80 A G 10: 79,194,760 T807A probably damaging Het
Wwox C T 8: 114,712,133 P313L probably benign Het
Zfp317 A G 9: 19,647,848 I453V possibly damaging Het
Other mutations in Zap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
murdock APN 1 36779704 missense probably damaging 0.99
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 splice site probably benign
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense probably damaging 1.00
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
wanna4 UTSW 1 36781365 missense probably damaging 1.00
want_to UTSW 1 36782517 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
zipper UTSW 1 36770902 missense probably benign 0.09
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site probably benign
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron probably benign
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36782517 missense probably damaging 1.00
R6825:Zap70 UTSW 1 36778390 missense probably damaging 1.00
R7039:Zap70 UTSW 1 36778751 missense probably benign
R7704:Zap70 UTSW 1 36779314 critical splice donor site probably null
R7769:Zap70 UTSW 1 36770902 missense probably benign 0.09
R8115:Zap70 UTSW 1 36781206 missense probably damaging 1.00
R8140:Zap70 UTSW 1 36771181 missense possibly damaging 0.89
R8289:Zap70 UTSW 1 36781137 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Z1176:Zap70 UTSW 1 36779176 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAACGCCTTTGCACCCACAG -3'
(R):5'- TAGTCGCGCACCATAGCATCAC -3'

Sequencing Primer
(F):5'- CACAGGGTCCAGCGATG -3'
(R):5'- TAGCATCACGCAGGCAGTC -3'
Posted On2014-04-13