Incidental Mutation 'R1520:Srp54b'
ID167389
Institutional Source Beutler Lab
Gene Symbol Srp54b
Ensembl Gene ENSMUSG00000112449
Gene Namesignal recognition particle 54B
Synonyms
MMRRC Submission 039564-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R1520 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location55155104-55189573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55257569 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 434 (M434T)
Ref Sequence ENSEMBL: ENSMUSP00000151681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164243] [ENSMUST00000218879]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164243
AA Change: M434T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132835
Gene: ENSMUSG00000079108
AA Change: M434T

DomainStartEndE-ValueType
SRP54_N 2 87 7.47e-19 SMART
AAA 100 277 2.15e-7 SMART
SRP54 101 296 7.25e-90 SMART
Pfam:SRP_SPB 326 431 9.2e-33 PFAM
low complexity region 490 504 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000218879
AA Change: M434T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,297 Y410* probably null Het
1810011H11Rik A T 14: 32,805,126 probably benign Het
Abca7 A G 10: 80,008,830 N1491S possibly damaging Het
Abcb1b G A 5: 8,814,768 A249T probably damaging Het
Acacb A G 5: 114,201,940 D804G possibly damaging Het
Agpat3 A T 10: 78,288,023 M1K probably null Het
Akr1c12 A C 13: 4,276,299 I61R probably damaging Het
Antxr2 G A 5: 97,960,692 A320V probably benign Het
Arhgef1 A G 7: 24,919,704 R454G probably damaging Het
C1ql4 T C 15: 99,087,667 H21R probably benign Het
Celsr3 T C 9: 108,848,658 S3029P probably damaging Het
Chaf1a T C 17: 56,047,302 C191R unknown Het
Corin A C 5: 72,330,895 C627G probably damaging Het
Cyp3a11 T C 5: 145,862,453 Y308C probably damaging Het
Cyp4a32 A G 4: 115,614,652 N420S probably damaging Het
Eftud2 A G 11: 102,839,440 S889P probably damaging Het
Eng A G 2: 32,672,941 H267R probably benign Het
Ep400 A G 5: 110,691,778 probably benign Het
Fmo9 G T 1: 166,667,455 H292Q probably benign Het
Frmpd4 T C X: 167,492,953 S373G probably damaging Het
Fsip2 T A 2: 82,980,714 I2459K possibly damaging Het
Gbp5 A T 3: 142,508,014 H523L probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gpr65 T C 12: 98,275,175 V29A probably benign Het
Igkv7-33 T A 6: 70,059,148 probably benign Het
Iqcc G A 4: 129,616,969 T251I possibly damaging Het
Jund A G 8: 70,699,274 T73A probably benign Het
Kif14 A G 1: 136,503,324 D1153G probably benign Het
Mcm8 T C 2: 132,839,455 V617A probably benign Het
Mdga1 A G 17: 29,846,519 F646L probably benign Het
Morc3 A G 16: 93,844,241 K54E probably damaging Het
Mutyh T C 4: 116,817,552 L357P probably damaging Het
Mylk4 T C 13: 32,712,838 probably null Het
Olfr1287 G A 2: 111,449,274 V45I probably benign Het
Osbpl3 T A 6: 50,346,431 D224V possibly damaging Het
Parp4 T C 14: 56,598,406 I469T probably damaging Het
Pkd1l2 A G 8: 117,046,159 V1043A probably benign Het
Plod3 A G 5: 136,991,311 N460S probably damaging Het
Preb A G 5: 30,958,524 F192L probably benign Het
Prkra T C 2: 76,639,278 T146A possibly damaging Het
Rag2 T C 2: 101,630,131 I262T probably damaging Het
Rgr A G 14: 37,044,715 W125R probably damaging Het
Rit1 T A 3: 88,729,313 F211I probably benign Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Serinc2 C T 4: 130,260,750 V234I probably benign Het
Srrt C A 5: 137,298,766 R69L probably damaging Het
Sv2b A G 7: 75,157,329 L191P probably damaging Het
Tcf12 C A 9: 71,883,106 probably null Het
Tmem87b T C 2: 128,839,256 probably null Het
Ttn T C 2: 76,817,048 E11031G possibly damaging Het
Uaca A T 9: 60,871,381 T1017S probably benign Het
Urb1 C A 16: 90,774,745 V1059L probably benign Het
V1rd19 G A 7: 24,003,198 A30T probably damaging Het
Vldlr C T 19: 27,240,543 L91F probably damaging Het
Vldlr G T 19: 27,247,066 A770S possibly damaging Het
Vmn2r80 A G 10: 79,194,760 T807A probably damaging Het
Wwox C T 8: 114,712,133 P313L probably benign Het
Zap70 T C 1: 36,770,955 S49P probably damaging Het
Zfp317 A G 9: 19,647,848 I453V possibly damaging Het
Other mutations in Srp54b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Srp54b APN 12 55252775 missense probably benign 0.39
R0101:Srp54b UTSW 12 55255620 splice site probably benign
R0395:Srp54b UTSW 12 55250099 missense probably damaging 1.00
R1076:Srp54b UTSW 12 55255528 splice site probably benign
R1186:Srp54b UTSW 12 55255528 splice site probably benign
R1541:Srp54b UTSW 12 55256059 missense probably benign 0.27
R1732:Srp54b UTSW 12 55252759 splice site probably null
R1836:Srp54b UTSW 12 55250160 splice site probably null
R5344:Srp54b UTSW 12 55255581 missense probably damaging 1.00
R5841:Srp54b UTSW 12 55252829 missense probably benign 0.01
R6269:Srp54b UTSW 12 55255972 missense possibly damaging 0.94
R6417:Srp54b UTSW 12 55250070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGAGTGCTTGGCTACTGTGATA -3'
(R):5'- ACAGCAACTGTTGTCTCCAATAGGACT -3'

Sequencing Primer
(F):5'- GCTTGGCTACTGTGATAATGAATG -3'
(R):5'- gggacagaacccagggac -3'
Posted On2014-04-13