Incidental Mutation 'R1526:Ceacam5'
ID 167429
Institutional Source Beutler Lab
Gene Symbol Ceacam5
Ensembl Gene ENSMUSG00000008789
Gene Name CEA cell adhesion molecule 5
Synonyms Psg30, 1600029H12Rik
MMRRC Submission 039566-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R1526 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 17447163-17495057 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 17484620 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 454 (G454D)
Ref Sequence ENSEMBL: ENSMUSP00000080582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081907]
AlphaFold Q3UKK2
Predicted Effect probably damaging
Transcript: ENSMUST00000081907
AA Change: G454D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080582
Gene: ENSMUSG00000008789
AA Change: G454D

DomainStartEndE-ValueType
IG 40 141 4.46e-1 SMART
IG_like 160 261 2.96e1 SMART
IG_like 277 378 5.86e0 SMART
IG_like 397 496 4.07e1 SMART
IG 514 615 2.64e0 SMART
IG_like 634 735 2.81e1 SMART
IG 753 853 1.72e-2 SMART
IGc2 869 933 1.28e-10 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 G T 12: 21,235,188 (GRCm39) A97S probably damaging Het
Brd10 T C 19: 29,712,545 (GRCm39) K785E probably damaging Het
C1qtnf1 A T 11: 118,334,616 (GRCm39) E32V possibly damaging Het
Ccdc81 A G 7: 89,525,081 (GRCm39) L500P probably damaging Het
Cdo1 T C 18: 46,861,130 (GRCm39) E27G probably benign Het
Cemip T C 7: 83,600,648 (GRCm39) D991G probably damaging Het
Cep170 A C 1: 176,616,071 (GRCm39) I79S probably damaging Het
Cep19 A G 16: 31,926,039 (GRCm39) Q149R possibly damaging Het
Cideb A T 14: 55,992,619 (GRCm39) L99* probably null Het
Cntnap5a A G 1: 116,356,207 (GRCm39) N746S probably benign Het
Col12a1 T C 9: 79,564,080 (GRCm39) N1715S probably benign Het
Col3a1 T C 1: 45,360,848 (GRCm39) S93P unknown Het
Csmd3 C A 15: 47,449,028 (GRCm39) probably null Het
Disp3 T C 4: 148,344,373 (GRCm39) I510V probably benign Het
Drosha T A 15: 12,914,070 (GRCm39) V1115E probably damaging Het
Dzip3 A C 16: 48,757,369 (GRCm39) L888R probably damaging Het
Emx2 C A 19: 59,452,442 (GRCm39) A242E probably benign Het
Fto G A 8: 92,168,314 (GRCm39) E256K possibly damaging Het
Gabrb2 A C 11: 42,482,715 (GRCm39) Y191S possibly damaging Het
Gm6526 A T 14: 43,987,394 (GRCm39) H110L probably damaging Het
Grin3b T A 10: 79,810,436 (GRCm39) N647K probably damaging Het
Ifit2 T G 19: 34,550,602 (GRCm39) S47R probably benign Het
Il5ra A T 6: 106,712,781 (GRCm39) V244E possibly damaging Het
Inppl1 A G 7: 101,482,153 (GRCm39) L141P probably benign Het
Iws1 A G 18: 32,213,178 (GRCm39) D202G probably benign Het
Kctd4 A C 14: 76,200,523 (GRCm39) I165L probably benign Het
Lrch3 G A 16: 32,770,746 (GRCm39) C116Y probably damaging Het
Mettl25 T C 10: 105,668,844 (GRCm39) T93A possibly damaging Het
Mgat4d A G 8: 84,095,666 (GRCm39) I314V probably benign Het
Mrgprb4 A T 7: 47,848,159 (GRCm39) Y256* probably null Het
Myo9b G T 8: 71,808,408 (GRCm39) V1672L probably damaging Het
Nek1 C T 8: 61,502,975 (GRCm39) P449L probably benign Het
Nucb2 G A 7: 116,123,642 (GRCm39) probably null Het
Obscn T C 11: 58,919,412 (GRCm39) Y6864C probably damaging Het
Omt2b A T 9: 78,235,420 (GRCm39) probably benign Het
Or2y3 T A 17: 38,393,486 (GRCm39) I128F probably damaging Het
Or4p18 C T 2: 88,232,777 (GRCm39) C167Y probably damaging Het
Or5ac15 G A 16: 58,940,293 (GRCm39) L47F probably damaging Het
Or6c208 A G 10: 129,224,176 (GRCm39) K225E probably benign Het
Otogl G T 10: 107,705,387 (GRCm39) P647T probably damaging Het
Oxnad1 A G 14: 31,824,244 (GRCm39) D271G probably benign Het
Pbx3 T C 2: 34,261,776 (GRCm39) I53V probably damaging Het
Pds5b T A 5: 150,639,865 (GRCm39) probably null Het
Ppp4r3a A T 12: 101,007,000 (GRCm39) D810E probably damaging Het
Ptpro A T 6: 137,438,724 (GRCm39) D1189V probably damaging Het
Ryr3 T C 2: 112,492,002 (GRCm39) N3758S probably damaging Het
Scarb2 G A 5: 92,594,200 (GRCm39) T454M possibly damaging Het
Sec23a A C 12: 59,032,972 (GRCm39) probably null Het
Spire2 C T 8: 124,095,502 (GRCm39) A535V probably benign Het
Svopl A T 6: 38,006,570 (GRCm39) F142L probably benign Het
Tas2r144 T C 6: 42,192,674 (GRCm39) I138T probably benign Het
Tbc1d15 A G 10: 115,039,135 (GRCm39) M535T probably benign Het
Tnfaip1 C T 11: 78,420,971 (GRCm39) V30M possibly damaging Het
Topaz1 T A 9: 122,625,108 (GRCm39) W1398R probably damaging Het
Tpo A G 12: 30,134,694 (GRCm39) S755P probably damaging Het
Ttn G T 2: 76,606,460 (GRCm39) S18116R probably damaging Het
Vmn2r78 A G 7: 86,571,465 (GRCm39) probably null Het
Wdr49 T A 3: 75,304,227 (GRCm39) K494M probably benign Het
Yeats2 A G 16: 20,024,836 (GRCm39) M697V probably damaging Het
Zfp407 G A 18: 84,579,158 (GRCm39) P652S possibly damaging Het
Zfp462 A G 4: 55,009,002 (GRCm39) M323V probably benign Het
Zfp629 G T 7: 127,209,931 (GRCm39) P626Q possibly damaging Het
Zfp804a A T 2: 82,088,532 (GRCm39) Y787F probably benign Het
Other mutations in Ceacam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Ceacam5 APN 7 17,493,481 (GRCm39) nonsense probably null
IGL00981:Ceacam5 APN 7 17,479,458 (GRCm39) missense probably benign 0.08
IGL01314:Ceacam5 APN 7 17,481,181 (GRCm39) nonsense probably null
IGL01329:Ceacam5 APN 7 17,479,534 (GRCm39) missense probably damaging 0.98
IGL01389:Ceacam5 APN 7 17,481,300 (GRCm39) missense probably damaging 0.96
IGL01418:Ceacam5 APN 7 17,479,524 (GRCm39) missense probably damaging 1.00
IGL02418:Ceacam5 APN 7 17,493,359 (GRCm39) missense possibly damaging 0.71
IGL02734:Ceacam5 APN 7 17,484,737 (GRCm39) missense probably damaging 1.00
IGL03220:Ceacam5 APN 7 17,494,653 (GRCm39) missense probably damaging 1.00
IGL03377:Ceacam5 APN 7 17,449,056 (GRCm39) missense probably benign 0.15
IGL03395:Ceacam5 APN 7 17,479,304 (GRCm39) splice site probably benign
IGL03054:Ceacam5 UTSW 7 17,493,379 (GRCm39) missense possibly damaging 0.71
R0456:Ceacam5 UTSW 7 17,494,776 (GRCm39) missense possibly damaging 0.63
R0624:Ceacam5 UTSW 7 17,448,888 (GRCm39) missense probably benign 0.03
R0847:Ceacam5 UTSW 7 17,491,762 (GRCm39) missense possibly damaging 0.71
R0879:Ceacam5 UTSW 7 17,491,627 (GRCm39) missense probably benign 0.16
R0945:Ceacam5 UTSW 7 17,481,269 (GRCm39) missense probably damaging 1.00
R1382:Ceacam5 UTSW 7 17,486,090 (GRCm39) missense probably benign 0.33
R1474:Ceacam5 UTSW 7 17,481,159 (GRCm39) missense probably damaging 1.00
R1793:Ceacam5 UTSW 7 17,481,320 (GRCm39) missense probably benign 0.01
R1851:Ceacam5 UTSW 7 17,448,835 (GRCm39) nonsense probably null
R1907:Ceacam5 UTSW 7 17,486,309 (GRCm39) missense possibly damaging 0.85
R1913:Ceacam5 UTSW 7 17,493,502 (GRCm39) nonsense probably null
R1990:Ceacam5 UTSW 7 17,491,805 (GRCm39) missense probably damaging 0.99
R1999:Ceacam5 UTSW 7 17,481,172 (GRCm39) missense possibly damaging 0.66
R2336:Ceacam5 UTSW 7 17,481,300 (GRCm39) missense probably benign 0.28
R2355:Ceacam5 UTSW 7 17,479,560 (GRCm39) missense probably damaging 1.00
R3106:Ceacam5 UTSW 7 17,481,248 (GRCm39) missense probably benign 0.06
R3423:Ceacam5 UTSW 7 17,491,562 (GRCm39) missense possibly damaging 0.52
R3432:Ceacam5 UTSW 7 17,448,901 (GRCm39) missense probably benign 0.06
R3686:Ceacam5 UTSW 7 17,494,748 (GRCm39) missense possibly damaging 0.94
R3713:Ceacam5 UTSW 7 17,493,263 (GRCm39) missense possibly damaging 0.52
R3878:Ceacam5 UTSW 7 17,484,506 (GRCm39) missense probably damaging 1.00
R4214:Ceacam5 UTSW 7 17,486,076 (GRCm39) missense probably benign 0.00
R4335:Ceacam5 UTSW 7 17,486,054 (GRCm39) missense probably benign
R4725:Ceacam5 UTSW 7 17,494,602 (GRCm39) missense probably benign 0.26
R4823:Ceacam5 UTSW 7 17,491,669 (GRCm39) missense possibly damaging 0.71
R4833:Ceacam5 UTSW 7 17,486,183 (GRCm39) missense probably benign
R4986:Ceacam5 UTSW 7 17,491,758 (GRCm39) missense possibly damaging 0.85
R5099:Ceacam5 UTSW 7 17,479,513 (GRCm39) missense probably damaging 0.96
R5365:Ceacam5 UTSW 7 17,493,473 (GRCm39) missense probably damaging 0.98
R5522:Ceacam5 UTSW 7 17,449,005 (GRCm39) missense probably benign
R5605:Ceacam5 UTSW 7 17,481,161 (GRCm39) missense probably benign 0.03
R6199:Ceacam5 UTSW 7 17,448,810 (GRCm39) missense probably benign 0.00
R6222:Ceacam5 UTSW 7 17,479,472 (GRCm39) missense probably benign 0.15
R6320:Ceacam5 UTSW 7 17,481,123 (GRCm39) missense probably damaging 1.00
R6464:Ceacam5 UTSW 7 17,481,391 (GRCm39) critical splice donor site probably null
R6521:Ceacam5 UTSW 7 17,484,756 (GRCm39) critical splice donor site probably null
R6568:Ceacam5 UTSW 7 17,479,416 (GRCm39) missense probably damaging 1.00
R6573:Ceacam5 UTSW 7 17,447,372 (GRCm39) start codon destroyed probably null 0.70
R6814:Ceacam5 UTSW 7 17,486,212 (GRCm39) nonsense probably null
R6872:Ceacam5 UTSW 7 17,486,212 (GRCm39) nonsense probably null
R6930:Ceacam5 UTSW 7 17,484,759 (GRCm39) splice site probably null
R7071:Ceacam5 UTSW 7 17,484,577 (GRCm39) missense possibly damaging 0.49
R7121:Ceacam5 UTSW 7 17,479,462 (GRCm39) missense probably benign 0.29
R7174:Ceacam5 UTSW 7 17,491,839 (GRCm39) critical splice donor site probably null
R7187:Ceacam5 UTSW 7 17,493,410 (GRCm39) missense possibly damaging 0.85
R7355:Ceacam5 UTSW 7 17,481,312 (GRCm39) missense probably damaging 1.00
R7411:Ceacam5 UTSW 7 17,484,678 (GRCm39) missense probably damaging 0.99
R7462:Ceacam5 UTSW 7 17,494,764 (GRCm39) missense probably damaging 1.00
R7612:Ceacam5 UTSW 7 17,493,341 (GRCm39) missense possibly damaging 0.86
R7803:Ceacam5 UTSW 7 17,493,317 (GRCm39) missense probably damaging 0.98
R7943:Ceacam5 UTSW 7 17,479,491 (GRCm39) missense probably benign 0.26
R8342:Ceacam5 UTSW 7 17,486,171 (GRCm39) missense possibly damaging 0.53
R8356:Ceacam5 UTSW 7 17,479,624 (GRCm39) missense possibly damaging 0.68
R8426:Ceacam5 UTSW 7 17,493,266 (GRCm39) missense possibly damaging 0.51
R8456:Ceacam5 UTSW 7 17,479,624 (GRCm39) missense possibly damaging 0.68
R8534:Ceacam5 UTSW 7 17,484,671 (GRCm39) missense probably benign 0.20
R8815:Ceacam5 UTSW 7 17,493,285 (GRCm39) missense possibly damaging 0.85
R8871:Ceacam5 UTSW 7 17,494,827 (GRCm39) missense probably benign 0.12
R9021:Ceacam5 UTSW 7 17,448,877 (GRCm39) missense possibly damaging 0.48
R9157:Ceacam5 UTSW 7 17,493,419 (GRCm39) missense possibly damaging 0.71
R9199:Ceacam5 UTSW 7 17,479,350 (GRCm39) missense probably benign 0.16
R9372:Ceacam5 UTSW 7 17,481,267 (GRCm39) missense possibly damaging 0.84
R9579:Ceacam5 UTSW 7 17,479,561 (GRCm39) missense probably damaging 1.00
R9605:Ceacam5 UTSW 7 17,493,520 (GRCm39) missense probably damaging 0.98
R9719:Ceacam5 UTSW 7 17,491,835 (GRCm39) missense probably damaging 0.97
X0020:Ceacam5 UTSW 7 17,494,834 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCAGTATAGAATCAGTGCCACC -3'
(R):5'- CTGTTTGGCTGTACCCTAAGTGTCC -3'

Sequencing Primer
(F):5'- CCACCGAGCATTGTTGAAG -3'
(R):5'- TGTACCCTAAGTGTCCTACACTAAG -3'
Posted On 2014-04-13