Mutagenetix > Incidental Mutations

Incidental Mutation 'R1526:Cemip'

167432

Institutional Source

Beutler Lab

Gene Symbol

Cemip

Ensembl Gene

ENSMUSG00000052353

Gene Name

cell migration inducing protein, hyaluronan binding

Synonyms

6330404C01Rik, 9930013L23Rik, 12H19.01.T7

MMRRC Submission

039566-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R1526 (G1)

Quality Score

220

Status

Not validated

Chromosome

Chromosomal Location

83932857-84086502 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83951440 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 991 (D991G)

Ref Sequence

ENSEMBL: ENSMUSP00000063277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064174]

Predicted Effect

probably damaging
Transcript: ENSMUST00000064174
AA Change: D991G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: D991G

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
G8	44	166	9.01e-42	SMART
Pfam:ILEI	187	281	2.1e-28	PFAM
Pfam:Mucin2_WxxW	324	403	1.2e-13	PFAM
PbH1	572	594	7.34e3	SMART
PbH1	595	617	3.73e3	SMART
PbH1	719	741	4.11e3	SMART
PbH1	798	819	6.96e2	SMART
Blast:PbH1	844	882	7e-17	BLAST
Blast:PbH1	917	952	2e-15	BLAST
Pfam:ILEI	1244	1334	2.7e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142518

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150495

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	T	C	19: 29,735,145	K785E	probably damaging	Het
Asap2	G	T	12: 21,185,187	A97S	probably damaging	Het
C1qtnf1	A	T	11: 118,443,790	E32V	possibly damaging	Het
Ccdc81	A	G	7: 89,875,873	L500P	probably damaging	Het
Cdo1	T	C	18: 46,728,063	E27G	probably benign	Het
Ceacam5	G	A	7: 17,750,695	G454D	probably damaging	Het
Cep170	A	C	1: 176,788,505	I79S	probably damaging	Het
Cep19	A	G	16: 32,107,221	Q149R	possibly damaging	Het
Cideb	A	T	14: 55,755,162	L99*	probably null	Het
Cntnap5a	A	G	1: 116,428,477	N746S	probably benign	Het
Col12a1	T	C	9: 79,656,798	N1715S	probably benign	Het
Col3a1	T	C	1: 45,321,688	S93P	unknown	Het
Csmd3	C	A	15: 47,585,632		probably null	Het
Disp3	T	C	4: 148,259,916	I510V	probably benign	Het
Drosha	T	A	15: 12,913,984	V1115E	probably damaging	Het
Dzip3	A	C	16: 48,937,006	L888R	probably damaging	Het
Emx2	C	A	19: 59,464,010	A242E	probably benign	Het
Fto	G	A	8: 91,441,686	E256K	possibly damaging	Het
Gabrb2	A	C	11: 42,591,888	Y191S	possibly damaging	Het
Gm6526	A	T	14: 43,749,937	H110L	probably damaging	Het
Grin3b	T	A	10: 79,974,602	N647K	probably damaging	Het
Ifit2	T	G	19: 34,573,202	S47R	probably benign	Het
Il5ra	A	T	6: 106,735,820	V244E	possibly damaging	Het
Inppl1	A	G	7: 101,832,946	L141P	probably benign	Het
Iws1	A	G	18: 32,080,125	D202G	probably benign	Het
Kctd4	A	C	14: 75,963,083	I165L	probably benign	Het
Lrch3	G	A	16: 32,950,376	C116Y	probably damaging	Het
Mettl25	T	C	10: 105,832,983	T93A	possibly damaging	Het
Mgat4d	A	G	8: 83,369,037	I314V	probably benign	Het
Mrgprb4	A	T	7: 48,198,411	Y256*	probably null	Het
Myo9b	G	T	8: 71,355,764	V1672L	probably damaging	Het
Nek1	C	T	8: 61,049,941	P449L	probably benign	Het
Nucb2	G	A	7: 116,524,407		probably null	Het
Obscn	T	C	11: 59,028,586	Y6864C	probably damaging	Het
Olfr1179	C	T	2: 88,402,433	C167Y	probably damaging	Het
Olfr131	T	A	17: 38,082,595	I128F	probably damaging	Het
Olfr194	G	A	16: 59,119,930	L47F	probably damaging	Het
Olfr784	A	G	10: 129,388,307	K225E	probably benign	Het
Omt2b	A	T	9: 78,328,138		probably benign	Het
Otogl	G	T	10: 107,869,526	P647T	probably damaging	Het
Oxnad1	A	G	14: 32,102,287	D271G	probably benign	Het
Pbx3	T	C	2: 34,371,764	I53V	probably damaging	Het
Pds5b	T	A	5: 150,716,400		probably null	Het
Ppp4r3a	A	T	12: 101,040,741	D810E	probably damaging	Het
Ptpro	A	T	6: 137,461,726	D1189V	probably damaging	Het
Ryr3	T	C	2: 112,661,657	N3758S	probably damaging	Het
Scarb2	G	A	5: 92,446,341	T454M	possibly damaging	Het
Sec23a	A	C	12: 58,986,186		probably null	Het
Spire2	C	T	8: 123,368,763	A535V	probably benign	Het
Svopl	A	T	6: 38,029,635	F142L	probably benign	Het
Tas2r144	T	C	6: 42,215,740	I138T	probably benign	Het
Tbc1d15	A	G	10: 115,203,230	M535T	probably benign	Het
Tnfaip1	C	T	11: 78,530,145	V30M	possibly damaging	Het
Topaz1	T	A	9: 122,796,043	W1398R	probably damaging	Het
Tpo	A	G	12: 30,084,695	S755P	probably damaging	Het
Ttn	G	T	2: 76,776,116	S18116R	probably damaging	Het
Vmn2r78	A	G	7: 86,922,257		probably null	Het
Wdr49	T	A	3: 75,396,920	K494M	probably benign	Het
Yeats2	A	G	16: 20,206,086	M697V	probably damaging	Het
Zfp407	G	A	18: 84,561,033	P652S	possibly damaging	Het
Zfp462	A	G	4: 55,009,002	M323V	probably benign	Het
Zfp629	G	T	7: 127,610,759	P626Q	possibly damaging	Het
Zfp804a	A	T	2: 82,258,188	Y787F	probably benign	Het

Other mutations in Cemip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:Cemip	APN	7	83947280	missense	possibly damaging	0.63
IGL01520:Cemip	APN	7	83948622	missense	probably benign	0.27
IGL01646:Cemip	APN	7	83983232	missense	possibly damaging	0.81
IGL02057:Cemip	APN	7	83987453	missense	probably damaging	1.00
IGL02058:Cemip	APN	7	83997292	missense	probably damaging	0.99
IGL02120:Cemip	APN	7	83951563	missense	probably damaging	0.99
IGL02278:Cemip	APN	7	83937438	missense	probably damaging	1.00
IGL02331:Cemip	APN	7	83963984	critical splice donor site	probably null
IGL02366:Cemip	APN	7	83943641	missense	probably benign	0.08
IGL02434:Cemip	APN	7	83955284	missense	probably damaging	0.98
IGL02622:Cemip	APN	7	83964175	missense	probably damaging	1.00
IGL02958:Cemip	APN	7	83975055	missense	probably damaging	0.99
IGL02979:Cemip	APN	7	84003306	splice site	probably benign
IGL03280:Cemip	APN	7	83987330	splice site	probably benign
IGL03400:Cemip	APN	7	83958516	missense	probably damaging	0.96
IGL03134:Cemip	UTSW	7	83999237	missense	probably damaging	1.00
PIT4618001:Cemip	UTSW	7	83943939	missense	probably benign	0.07
R0149:Cemip	UTSW	7	83964010	missense	probably benign
R0212:Cemip	UTSW	7	83973190	missense	probably damaging	0.99
R0361:Cemip	UTSW	7	83964010	missense	probably benign
R0565:Cemip	UTSW	7	83964110	missense	probably damaging	0.99
R0727:Cemip	UTSW	7	83961578	missense	probably benign	0.00
R1342:Cemip	UTSW	7	83944075	nonsense	probably null
R1456:Cemip	UTSW	7	83998510	missense	possibly damaging	0.96
R1676:Cemip	UTSW	7	83964038	missense	possibly damaging	0.77
R1718:Cemip	UTSW	7	83935658	missense	probably benign	0.00
R2234:Cemip	UTSW	7	83998562	missense	probably benign	0.02
R2513:Cemip	UTSW	7	83942025	missense	probably benign	0.11
R3788:Cemip	UTSW	7	83943898	missense	probably damaging	1.00
R3964:Cemip	UTSW	7	83951509	missense	probably benign	0.43
R3966:Cemip	UTSW	7	83951509	missense	probably benign	0.43
R4436:Cemip	UTSW	7	83987429	missense	probably null	0.43
R4584:Cemip	UTSW	7	83958539	missense	probably damaging	1.00
R4601:Cemip	UTSW	7	83951618	missense	probably damaging	0.98
R4717:Cemip	UTSW	7	83947280	missense	probably damaging	0.97
R4767:Cemip	UTSW	7	83973306	missense	probably damaging	1.00
R4822:Cemip	UTSW	7	83973241	missense	probably benign	0.27
R4849:Cemip	UTSW	7	83935737	missense	possibly damaging	0.52
R4910:Cemip	UTSW	7	83997411	missense	probably damaging	1.00
R4911:Cemip	UTSW	7	83983253	missense	probably damaging	1.00
R4922:Cemip	UTSW	7	83947100	intron	probably benign
R4924:Cemip	UTSW	7	83952938	missense	probably damaging	1.00
R5090:Cemip	UTSW	7	83942135	missense	probably damaging	1.00
R5310:Cemip	UTSW	7	83992033	missense	probably damaging	1.00
R5327:Cemip	UTSW	7	83955301	missense	probably damaging	0.99
R5378:Cemip	UTSW	7	83958525	missense	probably damaging	1.00
R5444:Cemip	UTSW	7	83982291	missense	probably damaging	0.98
R5644:Cemip	UTSW	7	83989184	missense	probably benign	0.03
R5688:Cemip	UTSW	7	83961641	missense	probably damaging	1.00
R5714:Cemip	UTSW	7	83975179	missense	probably damaging	1.00
R6170:Cemip	UTSW	7	83947230	missense	possibly damaging	0.89
R6505:Cemip	UTSW	7	83951597	nonsense	probably null
R6713:Cemip	UTSW	7	83943637	missense	probably benign	0.03
R6767:Cemip	UTSW	7	83998624	missense	probably damaging	1.00
R6817:Cemip	UTSW	7	83987992	missense	probably damaging	1.00
R6896:Cemip	UTSW	7	83998576	missense	probably damaging	1.00
R6945:Cemip	UTSW	7	83998547	missense	probably damaging	1.00
R7236:Cemip	UTSW	7	83948804	splice site	probably null
R7410:Cemip	UTSW	7	83952834	missense	probably damaging	1.00
R7483:Cemip	UTSW	7	83998576	missense	probably damaging	0.99
R7734:Cemip	UTSW	7	83957664	nonsense	probably null
R7924:Cemip	UTSW	7	83943715	splice site	probably benign
R7962:Cemip	UTSW	7	84003408	start gained	probably benign
R7988:Cemip	UTSW	7	84003408	start gained	probably benign
R7993:Cemip	UTSW	7	83964175	missense	probably damaging	1.00
R8005:Cemip	UTSW	7	84003408	start gained	probably benign
R8077:Cemip	UTSW	7	84003408	start gained	probably benign
R8130:Cemip	UTSW	7	83947176	missense	probably benign
R8131:Cemip	UTSW	7	84003408	start gained	probably benign
R8172:Cemip	UTSW	7	83997225	missense	probably damaging	1.00
R8220:Cemip	UTSW	7	83947160	missense	probably damaging	1.00
R8345:Cemip	UTSW	7	83942165	critical splice acceptor site	probably null
R8391:Cemip	UTSW	7	83955309	missense	probably damaging	0.99
R8492:Cemip	UTSW	7	83973214	missense	probably damaging	0.99
R8496:Cemip	UTSW	7	83951426	missense	probably benign	0.00
RF008:Cemip	UTSW	7	83961635	missense	probably damaging	0.99
T0970:Cemip	UTSW	7	83983146	missense	probably damaging	0.99
X0067:Cemip	UTSW	7	83947208	missense	probably damaging	0.98
Z1177:Cemip	UTSW	7	83947296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTGCATCATTCTTGGCCCAAC -3'
(R):5'- AAACTTTGCCCTGGCCTGATGACG -3'

Sequencing Primer
(F):5'- TTGGCCCAACATAGAACTAACTGG -3'
(R):5'- GGGCTCTGTTCAGATTACTTCCAG -3'

Posted On

2014-04-13