Mutagenetix > Incidental Mutations

Incidental Mutation 'R1526:Nek1'

167438

Institutional Source

Beutler Lab

Gene Symbol

Nek1

Ensembl Gene

ENSMUSG00000031644

Gene Name

NIMA (never in mitosis gene a)-related expressed kinase 1

Synonyms

kidney, anemia and testis, kat, D8Ertd790e

MMRRC Submission

039566-MU

Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1526 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60993195-61131346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 61049941 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 449 (P449L)

Ref Sequence

ENSEMBL: ENSMUSP00000147258 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]

Predicted Effect

probably benign
Transcript: ENSMUST00000034065
AA Change: P474L

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644
AA Change: P474L

Domain	Start	End	E-Value	Type
S_TKc	4	258	4.23e-95	SMART
Blast:S_TKc	266	303	3e-7	BLAST
low complexity region	321	337	N/A	INTRINSIC
coiled coil region	372	402	N/A	INTRINSIC
coiled coil region	556	592	N/A	INTRINSIC
coiled coil region	647	685	N/A	INTRINSIC
low complexity region	767	780	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120689
AA Change: P474L

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644
AA Change: P474L

Domain	Start	End	E-Value	Type
S_TKc	4	258	4.23e-95	SMART
Blast:S_TKc	266	303	3e-7	BLAST
low complexity region	321	337	N/A	INTRINSIC
coiled coil region	372	402	N/A	INTRINSIC
coiled coil region	487	510	N/A	INTRINSIC
low complexity region	521	533	N/A	INTRINSIC
coiled coil region	584	620	N/A	INTRINSIC
coiled coil region	675	713	N/A	INTRINSIC
low complexity region	795	808	N/A	INTRINSIC
low complexity region	1158	1169	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142601

SMART Domains

Protein: ENSMUSP00000121479
Gene: ENSMUSG00000031644

Domain	Start	End	E-Value	Type
low complexity region	38	47	N/A	INTRINSIC
coiled coil region	162	198	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155664

Predicted Effect

probably benign
Transcript: ENSMUST00000211256
AA Change: P449L

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211661

Predicted Effect

probably benign
Transcript: ENSMUST00000211672
AA Change: P474L

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.8%

Validation Efficiency

MGI Phenotype

Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	T	C	19: 29,735,145	K785E	probably damaging	Het
Asap2	G	T	12: 21,185,187	A97S	probably damaging	Het
C1qtnf1	A	T	11: 118,443,790	E32V	possibly damaging	Het
Ccdc81	A	G	7: 89,875,873	L500P	probably damaging	Het
Cdo1	T	C	18: 46,728,063	E27G	probably benign	Het
Ceacam5	G	A	7: 17,750,695	G454D	probably damaging	Het
Cemip	T	C	7: 83,951,440	D991G	probably damaging	Het
Cep170	A	C	1: 176,788,505	I79S	probably damaging	Het
Cep19	A	G	16: 32,107,221	Q149R	possibly damaging	Het
Cideb	A	T	14: 55,755,162	L99*	probably null	Het
Cntnap5a	A	G	1: 116,428,477	N746S	probably benign	Het
Col12a1	T	C	9: 79,656,798	N1715S	probably benign	Het
Col3a1	T	C	1: 45,321,688	S93P	unknown	Het
Csmd3	C	A	15: 47,585,632		probably null	Het
Disp3	T	C	4: 148,259,916	I510V	probably benign	Het
Drosha	T	A	15: 12,913,984	V1115E	probably damaging	Het
Dzip3	A	C	16: 48,937,006	L888R	probably damaging	Het
Emx2	C	A	19: 59,464,010	A242E	probably benign	Het
Fto	G	A	8: 91,441,686	E256K	possibly damaging	Het
Gabrb2	A	C	11: 42,591,888	Y191S	possibly damaging	Het
Gm6526	A	T	14: 43,749,937	H110L	probably damaging	Het
Grin3b	T	A	10: 79,974,602	N647K	probably damaging	Het
Ifit2	T	G	19: 34,573,202	S47R	probably benign	Het
Il5ra	A	T	6: 106,735,820	V244E	possibly damaging	Het
Inppl1	A	G	7: 101,832,946	L141P	probably benign	Het
Iws1	A	G	18: 32,080,125	D202G	probably benign	Het
Kctd4	A	C	14: 75,963,083	I165L	probably benign	Het
Lrch3	G	A	16: 32,950,376	C116Y	probably damaging	Het
Mettl25	T	C	10: 105,832,983	T93A	possibly damaging	Het
Mgat4d	A	G	8: 83,369,037	I314V	probably benign	Het
Mrgprb4	A	T	7: 48,198,411	Y256*	probably null	Het
Myo9b	G	T	8: 71,355,764	V1672L	probably damaging	Het
Nucb2	G	A	7: 116,524,407		probably null	Het
Obscn	T	C	11: 59,028,586	Y6864C	probably damaging	Het
Olfr1179	C	T	2: 88,402,433	C167Y	probably damaging	Het
Olfr131	T	A	17: 38,082,595	I128F	probably damaging	Het
Olfr194	G	A	16: 59,119,930	L47F	probably damaging	Het
Olfr784	A	G	10: 129,388,307	K225E	probably benign	Het
Omt2b	A	T	9: 78,328,138		probably benign	Het
Otogl	G	T	10: 107,869,526	P647T	probably damaging	Het
Oxnad1	A	G	14: 32,102,287	D271G	probably benign	Het
Pbx3	T	C	2: 34,371,764	I53V	probably damaging	Het
Pds5b	T	A	5: 150,716,400		probably null	Het
Ppp4r3a	A	T	12: 101,040,741	D810E	probably damaging	Het
Ptpro	A	T	6: 137,461,726	D1189V	probably damaging	Het
Ryr3	T	C	2: 112,661,657	N3758S	probably damaging	Het
Scarb2	G	A	5: 92,446,341	T454M	possibly damaging	Het
Sec23a	A	C	12: 58,986,186		probably null	Het
Spire2	C	T	8: 123,368,763	A535V	probably benign	Het
Svopl	A	T	6: 38,029,635	F142L	probably benign	Het
Tas2r144	T	C	6: 42,215,740	I138T	probably benign	Het
Tbc1d15	A	G	10: 115,203,230	M535T	probably benign	Het
Tnfaip1	C	T	11: 78,530,145	V30M	possibly damaging	Het
Topaz1	T	A	9: 122,796,043	W1398R	probably damaging	Het
Tpo	A	G	12: 30,084,695	S755P	probably damaging	Het
Ttn	G	T	2: 76,776,116	S18116R	probably damaging	Het
Vmn2r78	A	G	7: 86,922,257		probably null	Het
Wdr49	T	A	3: 75,396,920	K494M	probably benign	Het
Yeats2	A	G	16: 20,206,086	M697V	probably damaging	Het
Zfp407	G	A	18: 84,561,033	P652S	possibly damaging	Het
Zfp462	A	G	4: 55,009,002	M323V	probably benign	Het
Zfp629	G	T	7: 127,610,759	P626Q	possibly damaging	Het
Zfp804a	A	T	2: 82,258,188	Y787F	probably benign	Het

Other mutations in Nek1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Nek1	APN	8	61043284	missense	probably benign	0.00
IGL01075:Nek1	APN	8	61124132	missense	possibly damaging	0.64
IGL01122:Nek1	APN	8	61120966	missense	possibly damaging	0.80
IGL01151:Nek1	APN	8	61020077	missense	probably damaging	1.00
IGL01286:Nek1	APN	8	61124216	missense	possibly damaging	0.64
IGL01377:Nek1	APN	8	61089456	missense	probably benign
IGL01485:Nek1	APN	8	61049826	missense	probably benign	0.02
IGL01688:Nek1	APN	8	61105597	nonsense	probably null
IGL01806:Nek1	APN	8	61124212	missense	possibly damaging	0.82
IGL02006:Nek1	APN	8	61104192	missense	probably benign	0.20
IGL02304:Nek1	APN	8	61012167	missense	probably damaging	1.00
IGL02659:Nek1	APN	8	61089480	missense	probably benign	0.16
IGL02662:Nek1	APN	8	61104184	missense	probably benign	0.00
IGL02801:Nek1	APN	8	61121061	critical splice donor site	probably null
IGL02806:Nek1	APN	8	61044086	missense	probably benign	0.15
IGL03037:Nek1	APN	8	61034052	missense	probably benign	0.16
IGL03252:Nek1	APN	8	61072330	nonsense	probably null
P0014:Nek1	UTSW	8	61071747	splice site	probably benign
R0019:Nek1	UTSW	8	61089734	missense	probably benign	0.01
R0403:Nek1	UTSW	8	61106855	missense	probably damaging	0.99
R0464:Nek1	UTSW	8	61072273	splice site	probably benign
R0726:Nek1	UTSW	8	61089592	missense	probably damaging	1.00
R0761:Nek1	UTSW	8	61089455	missense	probably benign
R0827:Nek1	UTSW	8	61105648	splice site	probably benign
R0972:Nek1	UTSW	8	61089431	splice site	probably null
R1268:Nek1	UTSW	8	61022264	missense	probably damaging	1.00
R1343:Nek1	UTSW	8	61028675	missense	probably damaging	1.00
R1415:Nek1	UTSW	8	61089686	missense	probably benign	0.00
R1466:Nek1	UTSW	8	61125136	splice site	probably benign
R1480:Nek1	UTSW	8	61124326	splice site	probably null
R1552:Nek1	UTSW	8	61006737	missense	probably damaging	0.99
R1606:Nek1	UTSW	8	61124276	missense	possibly damaging	0.82
R1650:Nek1	UTSW	8	61036076	missense	probably benign	0.00
R1757:Nek1	UTSW	8	61089813	splice site	probably null
R1808:Nek1	UTSW	8	61016230	missense	probably damaging	1.00
R1966:Nek1	UTSW	8	61016296	missense	probably damaging	1.00
R2067:Nek1	UTSW	8	61007162	missense	probably damaging	1.00
R2111:Nek1	UTSW	8	61124326	splice site	probably null
R2113:Nek1	UTSW	8	61016293	missense	probably damaging	1.00
R2143:Nek1	UTSW	8	61028696	missense	probably damaging	1.00
R2255:Nek1	UTSW	8	61089773	missense	probably damaging	1.00
R2422:Nek1	UTSW	8	61019901	missense	probably damaging	1.00
R3848:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R3849:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R3850:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R4418:Nek1	UTSW	8	61106864	missense	probably damaging	1.00
R4526:Nek1	UTSW	8	61106944	missense	probably damaging	0.99
R4533:Nek1	UTSW	8	61007213	missense	possibly damaging	0.95
R4544:Nek1	UTSW	8	61016304	nonsense	probably null
R4677:Nek1	UTSW	8	61028806	missense	probably damaging	0.99
R4739:Nek1	UTSW	8	61098511	missense	probably benign	0.32
R5068:Nek1	UTSW	8	61016296	missense	probably damaging	1.00
R5421:Nek1	UTSW	8	61006677	missense	possibly damaging	0.81
R5516:Nek1	UTSW	8	61089489	missense	probably benign	0.03
R5855:Nek1	UTSW	8	61016272	missense	probably damaging	1.00
R6125:Nek1	UTSW	8	61028701	missense	probably damaging	1.00
R6267:Nek1	UTSW	8	61072309	nonsense	probably null
R6292:Nek1	UTSW	8	61054736	intron	probably null
R6296:Nek1	UTSW	8	61072309	nonsense	probably null
R6458:Nek1	UTSW	8	61100012	missense	probably benign	0.00
R6568:Nek1	UTSW	8	61106821	missense	probably benign	0.00
R6629:Nek1	UTSW	8	61054333	intron	probably null
R6867:Nek1	UTSW	8	61072330	missense	possibly damaging	0.81
R7122:Nek1	UTSW	8	61106795	missense	probably benign	0.00
R7193:Nek1	UTSW	8	61073578	missense	probably damaging	0.99
R7272:Nek1	UTSW	8	61125086	missense	probably benign	0.34
R7356:Nek1	UTSW	8	61120960	missense	probably benign	0.02
R7368:Nek1	UTSW	8	61089707	missense	probably benign	0.24
R7478:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7479:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7512:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7715:Nek1	UTSW	8	61006760	missense	probably damaging	0.98
X0028:Nek1	UTSW	8	61043258	missense	probably benign	0.19
X0066:Nek1	UTSW	8	61125128	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAAACCTTTTACTTTCGGCCATGCG -3'
(R):5'- AGACACGGCCTTCAGTCTTTTCAG -3'

Sequencing Primer
(F):5'- GGCCATGCGTTTACCAATATG -3'
(R):5'- GAGTTTTCCTAATAGCACCAGC -3'

Posted On

2014-04-13