Mutagenetix > Incidental Mutations

Incidental Mutation 'R1526:Myo9b'

167439

Institutional Source

Beutler Lab

Gene Symbol

Myo9b

Ensembl Gene

ENSMUSG00000004677

Gene Name

myosin IXb

Synonyms

MMRRC Submission

039566-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.807) question?

Stock #

R1526 (G1)

Quality Score

205

Status

Not validated

Chromosome

Chromosomal Location

71272714-71360713 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 71355764 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 1672 (V1672L)

Ref Sequence

ENSEMBL: ENSMUSP00000148316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071935
AA Change: V1670L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: V1670L

Domain	Start	End	E-Value	Type
RA	15	114	3.7e-30	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	1.2e-3	SMART
IQ	978	1000	1.6e-5	SMART
IQ	1001	1022	4.3e-5	SMART
IQ	1023	1045	8.4e-5	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1232	1246	N/A	INTRINSIC
Blast:MYSc	1247	1323	3e-19	BLAST
low complexity region	1348	1359	N/A	INTRINSIC
coiled coil region	1563	1590	N/A	INTRINSIC
C1	1591	1639	1.7e-14	SMART
RhoGAP	1668	1843	4.7e-71	SMART
coiled coil region	1901	1925	N/A	INTRINSIC
low complexity region	1940	1952	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168839
AA Change: V1684L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: V1684L

Domain	Start	End	E-Value	Type
RA	15	114	5.79e-28	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	2.46e-1	SMART
IQ	978	1000	3.35e-3	SMART
IQ	1001	1022	8.84e-3	SMART
IQ	1023	1045	1.77e-2	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1234	1257	N/A	INTRINSIC
Blast:MYSc	1258	1334	3e-19	BLAST
low complexity region	1361	1372	N/A	INTRINSIC
low complexity region	1581	1601	N/A	INTRINSIC
C1	1605	1653	3.58e-12	SMART
RhoGAP	1682	1857	7.78e-69	SMART
coiled coil region	1915	1939	N/A	INTRINSIC
low complexity region	1954	1966	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170242
AA Change: V1684L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: V1684L

Domain	Start	End	E-Value	Type
RA	15	114	5.79e-28	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	2.46e-1	SMART
IQ	978	1000	3.35e-3	SMART
IQ	1001	1022	8.84e-3	SMART
IQ	1023	1045	1.77e-2	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1234	1257	N/A	INTRINSIC
Blast:MYSc	1258	1334	3e-19	BLAST
low complexity region	1361	1372	N/A	INTRINSIC
low complexity region	1581	1601	N/A	INTRINSIC
C1	1605	1653	3.58e-12	SMART
RhoGAP	1682	1857	7.78e-69	SMART
coiled coil region	1931	1955	N/A	INTRINSIC
low complexity region	1970	1982	N/A	INTRINSIC
low complexity region	1992	2003	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000212412
AA Change: V479L

Predicted Effect

probably damaging
Transcript: ENSMUST00000212935
AA Change: V1672L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	T	C	19: 29,735,145	K785E	probably damaging	Het
Asap2	G	T	12: 21,185,187	A97S	probably damaging	Het
C1qtnf1	A	T	11: 118,443,790	E32V	possibly damaging	Het
Ccdc81	A	G	7: 89,875,873	L500P	probably damaging	Het
Cdo1	T	C	18: 46,728,063	E27G	probably benign	Het
Ceacam5	G	A	7: 17,750,695	G454D	probably damaging	Het
Cemip	T	C	7: 83,951,440	D991G	probably damaging	Het
Cep170	A	C	1: 176,788,505	I79S	probably damaging	Het
Cep19	A	G	16: 32,107,221	Q149R	possibly damaging	Het
Cideb	A	T	14: 55,755,162	L99*	probably null	Het
Cntnap5a	A	G	1: 116,428,477	N746S	probably benign	Het
Col12a1	T	C	9: 79,656,798	N1715S	probably benign	Het
Col3a1	T	C	1: 45,321,688	S93P	unknown	Het
Csmd3	C	A	15: 47,585,632		probably null	Het
Disp3	T	C	4: 148,259,916	I510V	probably benign	Het
Drosha	T	A	15: 12,913,984	V1115E	probably damaging	Het
Dzip3	A	C	16: 48,937,006	L888R	probably damaging	Het
Emx2	C	A	19: 59,464,010	A242E	probably benign	Het
Fto	G	A	8: 91,441,686	E256K	possibly damaging	Het
Gabrb2	A	C	11: 42,591,888	Y191S	possibly damaging	Het
Gm6526	A	T	14: 43,749,937	H110L	probably damaging	Het
Grin3b	T	A	10: 79,974,602	N647K	probably damaging	Het
Ifit2	T	G	19: 34,573,202	S47R	probably benign	Het
Il5ra	A	T	6: 106,735,820	V244E	possibly damaging	Het
Inppl1	A	G	7: 101,832,946	L141P	probably benign	Het
Iws1	A	G	18: 32,080,125	D202G	probably benign	Het
Kctd4	A	C	14: 75,963,083	I165L	probably benign	Het
Lrch3	G	A	16: 32,950,376	C116Y	probably damaging	Het
Mettl25	T	C	10: 105,832,983	T93A	possibly damaging	Het
Mgat4d	A	G	8: 83,369,037	I314V	probably benign	Het
Mrgprb4	A	T	7: 48,198,411	Y256*	probably null	Het
Nek1	C	T	8: 61,049,941	P449L	probably benign	Het
Nucb2	G	A	7: 116,524,407		probably null	Het
Obscn	T	C	11: 59,028,586	Y6864C	probably damaging	Het
Olfr1179	C	T	2: 88,402,433	C167Y	probably damaging	Het
Olfr131	T	A	17: 38,082,595	I128F	probably damaging	Het
Olfr194	G	A	16: 59,119,930	L47F	probably damaging	Het
Olfr784	A	G	10: 129,388,307	K225E	probably benign	Het
Omt2b	A	T	9: 78,328,138		probably benign	Het
Otogl	G	T	10: 107,869,526	P647T	probably damaging	Het
Oxnad1	A	G	14: 32,102,287	D271G	probably benign	Het
Pbx3	T	C	2: 34,371,764	I53V	probably damaging	Het
Pds5b	T	A	5: 150,716,400		probably null	Het
Ppp4r3a	A	T	12: 101,040,741	D810E	probably damaging	Het
Ptpro	A	T	6: 137,461,726	D1189V	probably damaging	Het
Ryr3	T	C	2: 112,661,657	N3758S	probably damaging	Het
Scarb2	G	A	5: 92,446,341	T454M	possibly damaging	Het
Sec23a	A	C	12: 58,986,186		probably null	Het
Spire2	C	T	8: 123,368,763	A535V	probably benign	Het
Svopl	A	T	6: 38,029,635	F142L	probably benign	Het
Tas2r144	T	C	6: 42,215,740	I138T	probably benign	Het
Tbc1d15	A	G	10: 115,203,230	M535T	probably benign	Het
Tnfaip1	C	T	11: 78,530,145	V30M	possibly damaging	Het
Topaz1	T	A	9: 122,796,043	W1398R	probably damaging	Het
Tpo	A	G	12: 30,084,695	S755P	probably damaging	Het
Ttn	G	T	2: 76,776,116	S18116R	probably damaging	Het
Vmn2r78	A	G	7: 86,922,257		probably null	Het
Wdr49	T	A	3: 75,396,920	K494M	probably benign	Het
Yeats2	A	G	16: 20,206,086	M697V	probably damaging	Het
Zfp407	G	A	18: 84,561,033	P652S	possibly damaging	Het
Zfp462	A	G	4: 55,009,002	M323V	probably benign	Het
Zfp629	G	T	7: 127,610,759	P626Q	possibly damaging	Het
Zfp804a	A	T	2: 82,258,188	Y787F	probably benign	Het

Other mutations in Myo9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Myo9b	APN	8	71348735	missense	probably benign
IGL01020:Myo9b	APN	8	71352000	missense	probably benign
IGL01479:Myo9b	APN	8	71359342	missense	probably damaging	1.00
IGL01704:Myo9b	APN	8	71359642	missense	probably damaging	0.98
IGL01761:Myo9b	APN	8	71349152	missense	probably damaging	0.96
IGL01766:Myo9b	APN	8	71290517	missense	probably damaging	1.00
IGL01834:Myo9b	APN	8	71356318	missense	probably damaging	1.00
IGL01834:Myo9b	APN	8	71355257	missense	possibly damaging	0.93
IGL01838:Myo9b	APN	8	71334390	missense	probably damaging	0.99
IGL02318:Myo9b	APN	8	71354124	missense	probably damaging	0.98
IGL02333:Myo9b	APN	8	71358993	missense	possibly damaging	0.65
IGL02340:Myo9b	APN	8	71291045	missense	probably damaging	1.00
IGL02514:Myo9b	APN	8	71291006	missense	probably damaging	1.00
IGL02593:Myo9b	APN	8	71290773	missense	probably damaging	1.00
IGL03075:Myo9b	APN	8	71354527	missense	probably damaging	1.00
IGL03332:Myo9b	APN	8	71348774	missense	possibly damaging	0.78
avantgarde	UTSW	8	71344162	missense	probably damaging	1.00
Freaky	UTSW	8	71290819	missense	probably damaging	1.00
iconoclastic	UTSW	8	71290475	missense	probably benign	0.37
unconventional	UTSW	8	71348597	missense	probably benign	0.00
PIT4418001:Myo9b	UTSW	8	71322947	missense	probably damaging	1.00
PIT4651001:Myo9b	UTSW	8	71342812	missense	possibly damaging	0.83
R0023:Myo9b	UTSW	8	71333768	missense	probably damaging	1.00
R0103:Myo9b	UTSW	8	71323849	splice site	probably benign
R0103:Myo9b	UTSW	8	71323849	splice site	probably benign
R0144:Myo9b	UTSW	8	71346043	missense	probably damaging	1.00
R0207:Myo9b	UTSW	8	71355225	splice site	probably benign
R0226:Myo9b	UTSW	8	71353832	missense	probably damaging	1.00
R0227:Myo9b	UTSW	8	71344162	missense	probably damaging	1.00
R0244:Myo9b	UTSW	8	71321813	missense	probably damaging	1.00
R0277:Myo9b	UTSW	8	71355952	splice site	probably benign
R0362:Myo9b	UTSW	8	71347770	missense	probably damaging	1.00
R0689:Myo9b	UTSW	8	71330756	missense	probably damaging	1.00
R0844:Myo9b	UTSW	8	71290475	missense	probably benign	0.37
R1051:Myo9b	UTSW	8	71355822	missense	probably damaging	1.00
R1469:Myo9b	UTSW	8	71291036	missense	probably damaging	1.00
R1469:Myo9b	UTSW	8	71291036	missense	probably damaging	1.00
R1544:Myo9b	UTSW	8	71290976	missense	probably damaging	1.00
R1565:Myo9b	UTSW	8	71315192	missense	possibly damaging	0.46
R1645:Myo9b	UTSW	8	71322978	missense	probably damaging	1.00
R1745:Myo9b	UTSW	8	71354047	missense	probably damaging	1.00
R1820:Myo9b	UTSW	8	71333358	missense	probably damaging	1.00
R2037:Myo9b	UTSW	8	71290866	missense	probably damaging	1.00
R2050:Myo9b	UTSW	8	71290550	missense	probably damaging	1.00
R2056:Myo9b	UTSW	8	71359690	missense	possibly damaging	0.78
R2129:Myo9b	UTSW	8	71333699	missense	probably damaging	1.00
R2423:Myo9b	UTSW	8	71327940	missense	probably damaging	1.00
R2869:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2869:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2871:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2871:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2872:Myo9b	UTSW	8	71290966	missense	probably benign	0.01
R2872:Myo9b	UTSW	8	71290966	missense	probably benign	0.01
R2873:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2874:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2920:Myo9b	UTSW	8	71325857	missense	probably damaging	0.98
R2926:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2939:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2940:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3033:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3040:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3689:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3691:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3735:Myo9b	UTSW	8	71348597	missense	probably benign	0.00
R4194:Myo9b	UTSW	8	71359624	missense	possibly damaging	0.71
R4258:Myo9b	UTSW	8	71355765	missense	probably damaging	1.00
R4457:Myo9b	UTSW	8	71290999	missense	probably damaging	1.00
R4478:Myo9b	UTSW	8	71291081	missense	probably damaging	1.00
R4496:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R4544:Myo9b	UTSW	8	71327941	missense	probably damaging	1.00
R4580:Myo9b	UTSW	8	71315135	missense	probably damaging	1.00
R4736:Myo9b	UTSW	8	71356592	missense	probably damaging	1.00
R5068:Myo9b	UTSW	8	71349055	missense	probably damaging	1.00
R5124:Myo9b	UTSW	8	71355839	missense	probably damaging	1.00
R5194:Myo9b	UTSW	8	71349089	missense	probably benign	0.01
R5296:Myo9b	UTSW	8	71333388	missense	possibly damaging	0.69
R5528:Myo9b	UTSW	8	71323274	missense	probably benign	0.06
R5664:Myo9b	UTSW	8	71359882	missense	probably benign	0.13
R5677:Myo9b	UTSW	8	71343686	missense	probably damaging	1.00
R5680:Myo9b	UTSW	8	71290372	missense	probably benign	0.00
R5982:Myo9b	UTSW	8	71348396	missense	probably benign	0.05
R6344:Myo9b	UTSW	8	71327914	missense	probably damaging	1.00
R6352:Myo9b	UTSW	8	71348410	missense	probably benign	0.16
R6352:Myo9b	UTSW	8	71348411	missense	probably benign
R6411:Myo9b	UTSW	8	71322955	nonsense	probably null
R6425:Myo9b	UTSW	8	71333628	missense	probably damaging	1.00
R6505:Myo9b	UTSW	8	71355857	missense	possibly damaging	0.88
R6743:Myo9b	UTSW	8	71352159	splice site	probably null
R6811:Myo9b	UTSW	8	71356578	missense	probably damaging	1.00
R6813:Myo9b	UTSW	8	71323305	missense	probably damaging	1.00
R6954:Myo9b	UTSW	8	71290819	missense	probably damaging	1.00
R7124:Myo9b	UTSW	8	71333701	nonsense	probably null
R7255:Myo9b	UTSW	8	71290891	missense	probably damaging	1.00
R7293:Myo9b	UTSW	8	71325905	missense	probably benign	0.00
R7342:Myo9b	UTSW	8	71355774	missense	probably damaging	1.00
R7451:Myo9b	UTSW	8	71352188	missense	probably benign	0.28
R7482:Myo9b	UTSW	8	71342798	missense	probably benign	0.00
R7508:Myo9b	UTSW	8	71354801	missense	probably benign	0.00
R7957:Myo9b	UTSW	8	71354761	missense	probably benign	0.12
R8062:Myo9b	UTSW	8	71321813	missense	probably damaging	0.99
R8108:Myo9b	UTSW	8	71348342	missense	probably damaging	0.99
R8197:Myo9b	UTSW	8	71290963	missense	probably damaging	1.00
R8274:Myo9b	UTSW	8	71359836	missense	probably benign	0.00
R8686:Myo9b	UTSW	8	71334322	missense	probably benign	0.01
R8731:Myo9b	UTSW	8	71353842	critical splice donor site	probably null
R8924:Myo9b	UTSW	8	71349031	missense	probably benign
R9056:Myo9b	UTSW	8	71352262	missense	probably benign	0.17
R9117:Myo9b	UTSW	8	71347807	missense	probably benign	0.03
R9315:Myo9b	UTSW	8	71349167	missense	possibly damaging	0.54
R9332:Myo9b	UTSW	8	71359602	missense	probably benign	0.07
R9364:Myo9b	UTSW	8	71355839	missense	probably damaging	1.00
X0066:Myo9b	UTSW	8	71323898	missense	probably damaging	1.00
Z1177:Myo9b	UTSW	8	71290709	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAGTTGCTCTCTCCCAAGCATC -3'
(R):5'- TCACGAAGCCATTGCTTCAGGAC -3'

Sequencing Primer
(F):5'- GCATCCCTTCAAGGACAGAGTAG -3'
(R):5'- AGGGAAGTCTTCCAGCTTAACTG -3'

Posted On

2014-04-13