Mutagenetix > Incidental Mutation

Incidental Mutation 'R1522:Rgl1'

167486

Institutional Source

Beutler Lab

Gene Symbol

Rgl1

Ensembl Gene

ENSMUSG00000026482

Gene Name

ral guanine nucleotide dissociation stimulator,-like 1

Synonyms

Rgl

MMRRC Submission

040871-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.212) question?

Stock #

R1522 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

152516760-152766351 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 152586533 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 109 (L109Q)

Ref Sequence

ENSEMBL: ENSMUSP00000107490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027760] [ENSMUST00000111857] [ENSMUST00000111859] [ENSMUST00000149536]

AlphaFold

Q60695

Predicted Effect

probably damaging
Transcript: ENSMUST00000027760
AA Change: L74Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027760
Gene: ENSMUSG00000026482
AA Change: L74Q

Domain	Start	End	E-Value	Type
RasGEFN	64	196	5.86e-39	SMART
RasGEF	228	502	9.56e-116	SMART
Blast:RasGEF	522	582	6e-8	BLAST
low complexity region	585	596	N/A	INTRINSIC
low complexity region	627	637	N/A	INTRINSIC
RA	648	735	1.7e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111857
AA Change: L72Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482
AA Change: L72Q

Domain	Start	End	E-Value	Type
RasGEFN	62	194	5.86e-39	SMART
RasGEF	226	500	9.56e-116	SMART
Blast:RasGEF	520	580	7e-8	BLAST
low complexity region	583	594	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
RA	646	733	1.7e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111859
AA Change: L109Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482
AA Change: L109Q

Domain	Start	End	E-Value	Type
RasGEFN	99	231	5.86e-39	SMART
RasGEF	263	537	9.56e-116	SMART
Blast:RasGEF	557	617	6e-8	BLAST
low complexity region	620	631	N/A	INTRINSIC
low complexity region	662	672	N/A	INTRINSIC
RA	683	770	1.7e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128251

Predicted Effect

probably benign
Transcript: ENSMUST00000149536

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the Ras-like (Ral) -selective guanine nucleotide exchange factor (RalGEF) family of small GTPase activators which function both as downstream effectors of activated Ras GTPase and as regulators of certain Ral GTPases in the RalGEF - Ral GTPase signaling pathway. The encoded protein, like other RalGEFs, has an N-terminal ras exchanger motif domain, a catalytic CDC25 homology domain, and a C-terminal ras binding domain that stimulates guanine nucleotide exchange when bound to a Ral GTPase. RalGEF family members bridge the Ras and Ral signaling pathways and are thought to play a role in oncogenic transformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	T	C	6: 83,162,586	S498P	probably damaging	Het
3100002H09Rik	A	G	4: 124,610,694	W22R	probably damaging	Het
AA986860	A	G	1: 130,743,094	E351G	probably damaging	Het
Acsl5	T	C	19: 55,280,492	V195A	probably benign	Het
Adamts10	A	G	17: 33,537,319	D312G	probably benign	Het
Adgrb1	A	G	15: 74,580,617	M211V	probably damaging	Het
Ankfy1	C	T	11: 72,755,867	R859*	probably null	Het
Atp8b1	T	A	18: 64,550,432	I742L	probably benign	Het
B3galnt2	T	A	13: 13,970,769	V89E	probably damaging	Het
BC024978	A	G	7: 27,202,680	H244R	probably damaging	Het
Brinp3	A	C	1: 146,901,890	T692P	probably damaging	Het
C9	T	A	15: 6,486,762	F349I	probably damaging	Het
Cacna1a	T	A	8: 84,633,433	M1976K	probably benign	Het
Ccdc180	T	C	4: 45,927,975	V1170A	possibly damaging	Het
Celsr1	A	G	15: 85,931,276	V1846A	probably benign	Het
Ces1f	A	T	8: 93,271,889	Y160N	possibly damaging	Het
Cfap45	A	G	1: 172,540,572	E377G	probably damaging	Het
Clca3a1	T	A	3: 144,755,171	M240L	probably benign	Het
Clnk	G	A	5: 38,794,966	T10M	probably damaging	Het
Cntrl	T	A	2: 35,155,279	I781K	possibly damaging	Het
Col11a2	G	A	17: 34,055,254	G375S	probably damaging	Het
Col6a5	T	A	9: 105,939,994	I373F	unknown	Het
Dmxl1	C	T	18: 49,852,367	A227V	probably benign	Het
Dok5	A	G	2: 170,732,132	N4D	probably benign	Het
Dpysl3	A	T	18: 43,363,557	V138D	probably damaging	Het
Efs	A	T	14: 54,919,715	Y380N	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Farp2	A	G	1: 93,618,553	Q855R	possibly damaging	Het
Fcrls	A	C	3: 87,256,707	S372A	possibly damaging	Het
Gadl1	C	T	9: 115,944,229	A113V	probably damaging	Het
Gatsl2	T	G	5: 134,125,887	S43R	probably damaging	Het
Gda	T	A	19: 21,412,539	E219D	probably benign	Het
Gli1	A	T	10: 127,332,577	M469K	probably damaging	Het
Gm4847	A	T	1: 166,641,650	S148R	probably damaging	Het
Golga2	T	C	2: 32,302,204	V325A	probably benign	Het
Hpf1	A	G	8: 60,896,749	D137G	probably damaging	Het
Htr2a	C	G	14: 74,705,853	S291*	probably null	Het
Itga5	G	A	15: 103,356,782	Q233*	probably null	Het
Jazf1	C	A	6: 52,812,183	R102L	probably damaging	Het
Kif6	T	G	17: 49,714,113	L322R	probably damaging	Het
Ktn1	A	C	14: 47,667,416	K217T	probably damaging	Het
Lig4	A	T	8: 9,973,012	V256E	possibly damaging	Het
Lrp1	G	T	10: 127,567,364	D2113E	probably damaging	Het
Lrp1	A	T	10: 127,575,286	D1399E	probably benign	Het
Mmel1	A	G	4: 154,894,986	E717G	probably damaging	Het
Mndal	G	T	1: 173,871,466	P155H	possibly damaging	Het
Mycbpap	A	G	11: 94,511,623		probably null	Het
Nedd1	T	C	10: 92,719,614	E3G	probably damaging	Het
Nlgn1	A	T	3: 25,435,909	N551K	probably damaging	Het
Nup210	G	A	6: 91,069,166	P595L	possibly damaging	Het
Olfr117	A	T	17: 37,659,770	C188S	probably damaging	Het
Olfr1302	A	T	2: 111,780,348		probably null	Het
Olfr199	T	G	16: 59,215,984	T210P	probably damaging	Het
Olfr477	A	G	7: 107,990,533	H56R	probably benign	Het
Olfr697	A	G	7: 106,741,005	C310R	probably benign	Het
Pank3	G	A	11: 35,781,681	V304M	probably benign	Het
Phf3	G	A	1: 30,805,648	T1410I	probably benign	Het
Ppm1k	A	G	6: 57,525,157	I7T	possibly damaging	Het
Ppp1r12c	T	C	7: 4,497,425	D73G	probably damaging	Het
Prelid2	T	G	18: 41,881,267	M165L	probably benign	Het
Prkd3	A	C	17: 78,952,696	L826R	probably damaging	Het
Ptchd4	A	T	17: 42,503,542	N778I	probably damaging	Het
Ptprm	T	C	17: 66,693,871	D1063G	possibly damaging	Het
Rab27a	C	A	9: 73,075,482	T23N	probably damaging	Het
Rasgrf2	A	T	13: 91,896,086	F949L	probably benign	Het
Rbm33	A	G	5: 28,337,004	N68D	probably damaging	Het
Rnf20	A	G	4: 49,638,197	N103S	possibly damaging	Het
Sbno1	G	A	5: 124,392,612	L875F	probably damaging	Het
Scube1	T	A	15: 83,628,076		probably null	Het
Selenbp1	G	A	3: 94,937,358	V109M	probably damaging	Het
Serpina3c	T	A	12: 104,151,546	I178F	probably damaging	Het
Shisa8	C	T	15: 82,208,501	G63D	probably damaging	Het
Snx14	T	C	9: 88,402,224	R464G	possibly damaging	Het
Snx25	A	T	8: 46,124,082	M1K	probably null	Het
Sorcs3	C	A	19: 48,706,009	T574K	possibly damaging	Het
Syne2	A	G	12: 76,103,783	E6528G	probably damaging	Het
Syt5	T	C	7: 4,540,246	E338G	probably damaging	Het
Tbk1	T	C	10: 121,551,318	K691E	probably benign	Het
Tenm3	G	A	8: 48,395,576	T11I	probably damaging	Het
Thrb	A	G	14: 18,002,597	H87R	probably damaging	Het
Tlr4	T	A	4: 66,839,696	M242K	possibly damaging	Het
Tm4sf19	T	C	16: 32,406,002	M56T	possibly damaging	Het
Tmem212	T	A	3: 27,886,471	R66*	probably null	Het
Tmem39b	G	T	4: 129,684,482	D315E	probably benign	Het
Tnxb	T	C	17: 34,718,638	F3834L	probably damaging	Het
Trim36	A	T	18: 46,186,183	L225*	probably null	Het
Trim42	A	T	9: 97,365,679	H321Q	probably damaging	Het
Trio	G	T	15: 27,732,640	Q3052K	probably benign	Het
Trpm3	T	C	19: 22,978,334	I1091T	probably benign	Het
Tst	T	C	15: 78,399,943	E228G	possibly damaging	Het
Ttn	T	C	2: 76,871,716		probably benign	Het
Uap1	A	C	1: 170,150,941		probably null	Het
Ush2a	T	C	1: 188,797,814	S3267P	possibly damaging	Het
Usp5	T	C	6: 124,825,166	T38A	probably benign	Het
Uvssa	A	T	5: 33,387,808	Q84L	probably damaging	Het
Vmn1r159	T	G	7: 22,843,268	H113P	probably damaging	Het
Vps13d	A	T	4: 145,098,172		probably null	Het
Zfp182	T	A	X: 21,031,560	I166L	probably benign	Het
Zfp811	A	T	17: 32,797,648	Y472N	probably damaging	Het

Other mutations in Rgl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Rgl1	APN	1	152571617	missense	probably benign	0.02
IGL01065:Rgl1	APN	1	152519142	missense	probably damaging	1.00
IGL01390:Rgl1	APN	1	152571588	splice site	probably benign
IGL01726:Rgl1	APN	1	152519153	missense	probably damaging	1.00
IGL01837:Rgl1	APN	1	152549150	missense	probably damaging	1.00
IGL02019:Rgl1	APN	1	152528469	splice site	probably benign
IGL02369:Rgl1	APN	1	152533606	missense	probably damaging	1.00
R0240:Rgl1	UTSW	1	152554424	unclassified	probably benign
R0255:Rgl1	UTSW	1	152552596	missense	probably damaging	1.00
R0562:Rgl1	UTSW	1	152539945	missense	probably damaging	1.00
R0648:Rgl1	UTSW	1	152536265	critical splice donor site	probably null
R0734:Rgl1	UTSW	1	152554300	missense	probably damaging	0.98
R1187:Rgl1	UTSW	1	152544433	missense	probably benign	0.14
R1595:Rgl1	UTSW	1	152675023	splice site	probably benign
R1634:Rgl1	UTSW	1	152524772	missense	probably damaging	1.00
R1661:Rgl1	UTSW	1	152533575	missense	probably damaging	0.99
R1665:Rgl1	UTSW	1	152533575	missense	probably damaging	0.99
R1964:Rgl1	UTSW	1	152549104	missense	probably damaging	1.00
R2291:Rgl1	UTSW	1	152536281	missense	probably damaging	1.00
R4272:Rgl1	UTSW	1	152536289	missense	probably benign	0.13
R4668:Rgl1	UTSW	1	152521371	missense	probably damaging	1.00
R4669:Rgl1	UTSW	1	152521371	missense	probably damaging	1.00
R4747:Rgl1	UTSW	1	152524699	nonsense	probably null
R4830:Rgl1	UTSW	1	152554330	missense	probably benign	0.11
R4853:Rgl1	UTSW	1	152557574	missense	probably benign	0.07
R4969:Rgl1	UTSW	1	152549062	splice site	probably null
R5778:Rgl1	UTSW	1	152552421	missense	probably benign	0.05
R5979:Rgl1	UTSW	1	152557493	missense	probably damaging	1.00
R6180:Rgl1	UTSW	1	152519172	missense	probably damaging	1.00
R6183:Rgl1	UTSW	1	152586570	missense	possibly damaging	0.94
R6322:Rgl1	UTSW	1	152552435	missense	probably damaging	0.98
R6678:Rgl1	UTSW	1	152524724	missense	probably damaging	1.00
R6759:Rgl1	UTSW	1	152533530	missense	probably damaging	0.99
R6892:Rgl1	UTSW	1	152539940	missense	probably benign	0.00
R7290:Rgl1	UTSW	1	152544395	missense	possibly damaging	0.78
R7363:Rgl1	UTSW	1	152519163	missense	probably damaging	1.00
R7610:Rgl1	UTSW	1	152552620	missense	probably damaging	1.00
R7774:Rgl1	UTSW	1	152554350	missense	probably benign
R8140:Rgl1	UTSW	1	152557501	missense	probably damaging	1.00
R9188:Rgl1	UTSW	1	152519171	missense	probably damaging	1.00
R9190:Rgl1	UTSW	1	152552611	missense	probably damaging	0.96
R9297:Rgl1	UTSW	1	152524703	missense	possibly damaging	0.89
R9318:Rgl1	UTSW	1	152524703	missense	possibly damaging	0.89
R9491:Rgl1	UTSW	1	152549118	missense	probably damaging	1.00
R9570:Rgl1	UTSW	1	152554331	missense	possibly damaging	0.47
R9610:Rgl1	UTSW	1	152521364	missense	probably benign	0.13
R9640:Rgl1	UTSW	1	152521391	missense	probably damaging	1.00
RF005:Rgl1	UTSW	1	152521363	missense	probably benign
Z1088:Rgl1	UTSW	1	152675020	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCCTTGATTCAGAGCCACAC -3'
(R):5'- GAAAGAATGGGACGCTACCTCCAC -3'

Sequencing Primer
(F):5'- TTGATTCAGAGCCACACCCTTAG -3'
(R):5'- ACTGCCTTCCAGGACTTTCAG -3'

Posted On

2014-04-13