Incidental Mutation 'R1522:Or2ag15'
ID 167525
Institutional Source Beutler Lab
Gene Symbol Or2ag15
Ensembl Gene ENSMUSG00000051591
Gene Name olfactory receptor family 2 subfamily AG member 15
Synonyms GA_x6K02T2PBJ9-9119301-9118348, Olfr697, MOR283-5
MMRRC Submission 040871-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R1522 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 106340112-106341163 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106340212 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 310 (C310R)
Ref Sequence ENSEMBL: ENSMUSP00000152039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050541] [ENSMUST00000217734]
AlphaFold Q8VFM4
Predicted Effect probably benign
Transcript: ENSMUST00000050541
AA Change: C310R

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000055207
Gene: ENSMUSG00000051591
AA Change: C310R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4.7e-7 PFAM
Pfam:7tm_1 41 290 8.7e-26 PFAM
Pfam:7TM_GPCR_Srx 69 306 4.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217734
AA Change: C310R

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik T C 6: 83,139,568 (GRCm39) S498P probably damaging Het
3100002H09Rik A G 4: 124,504,487 (GRCm39) W22R probably damaging Het
AA986860 A G 1: 130,670,831 (GRCm39) E351G probably damaging Het
Acsl5 T C 19: 55,268,924 (GRCm39) V195A probably benign Het
Actmap A G 7: 26,902,105 (GRCm39) H244R probably damaging Het
Adamts10 A G 17: 33,756,293 (GRCm39) D312G probably benign Het
Adgrb1 A G 15: 74,452,466 (GRCm39) M211V probably damaging Het
Ankfy1 C T 11: 72,646,693 (GRCm39) R859* probably null Het
Atp8b1 T A 18: 64,683,503 (GRCm39) I742L probably benign Het
B3galnt2 T A 13: 14,145,354 (GRCm39) V89E probably damaging Het
Brinp3 A C 1: 146,777,628 (GRCm39) T692P probably damaging Het
C9 T A 15: 6,516,243 (GRCm39) F349I probably damaging Het
Cacna1a T A 8: 85,360,062 (GRCm39) M1976K probably benign Het
Castor2 T G 5: 134,154,726 (GRCm39) S43R probably damaging Het
Ccdc180 T C 4: 45,927,975 (GRCm39) V1170A possibly damaging Het
Celsr1 A G 15: 85,815,477 (GRCm39) V1846A probably benign Het
Ces1f A T 8: 93,998,517 (GRCm39) Y160N possibly damaging Het
Cfap45 A G 1: 172,368,139 (GRCm39) E377G probably damaging Het
Clca3a1 T A 3: 144,460,932 (GRCm39) M240L probably benign Het
Clnk G A 5: 38,952,309 (GRCm39) T10M probably damaging Het
Cntrl T A 2: 35,045,291 (GRCm39) I781K possibly damaging Het
Col11a2 G A 17: 34,274,228 (GRCm39) G375S probably damaging Het
Col6a5 T A 9: 105,817,193 (GRCm39) I373F unknown Het
Dmxl1 C T 18: 49,985,434 (GRCm39) A227V probably benign Het
Dok5 A G 2: 170,574,052 (GRCm39) N4D probably benign Het
Dpysl3 A T 18: 43,496,622 (GRCm39) V138D probably damaging Het
Efs A T 14: 55,157,172 (GRCm39) Y380N probably damaging Het
Eme2 G A 17: 25,111,892 (GRCm39) S263F probably damaging Het
Farp2 A G 1: 93,546,275 (GRCm39) Q855R possibly damaging Het
Fcrl2 A C 3: 87,164,014 (GRCm39) S372A possibly damaging Het
Gadl1 C T 9: 115,773,297 (GRCm39) A113V probably damaging Het
Gda T A 19: 21,389,903 (GRCm39) E219D probably benign Het
Gli1 A T 10: 127,168,446 (GRCm39) M469K probably damaging Het
Gm4847 A T 1: 166,469,219 (GRCm39) S148R probably damaging Het
Golga2 T C 2: 32,192,216 (GRCm39) V325A probably benign Het
Hpf1 A G 8: 61,349,783 (GRCm39) D137G probably damaging Het
Htr2a C G 14: 74,943,293 (GRCm39) S291* probably null Het
Itga5 G A 15: 103,265,209 (GRCm39) Q233* probably null Het
Jazf1 C A 6: 52,789,168 (GRCm39) R102L probably damaging Het
Kif6 T G 17: 50,021,141 (GRCm39) L322R probably damaging Het
Ktn1 A C 14: 47,904,873 (GRCm39) K217T probably damaging Het
Lig4 A T 8: 10,023,012 (GRCm39) V256E possibly damaging Het
Lrp1 G T 10: 127,403,233 (GRCm39) D2113E probably damaging Het
Lrp1 A T 10: 127,411,155 (GRCm39) D1399E probably benign Het
Mmel1 A G 4: 154,979,443 (GRCm39) E717G probably damaging Het
Mndal G T 1: 173,699,032 (GRCm39) P155H possibly damaging Het
Mycbpap A G 11: 94,402,449 (GRCm39) probably null Het
Nedd1 T C 10: 92,555,476 (GRCm39) E3G probably damaging Het
Nlgn1 A T 3: 25,490,073 (GRCm39) N551K probably damaging Het
Nup210 G A 6: 91,046,148 (GRCm39) P595L possibly damaging Het
Or2g25 A T 17: 37,970,661 (GRCm39) C188S probably damaging Het
Or4k52 A T 2: 111,610,693 (GRCm39) probably null Het
Or5ac17 T G 16: 59,036,347 (GRCm39) T210P probably damaging Het
Or5p56 A G 7: 107,589,740 (GRCm39) H56R probably benign Het
Pank3 G A 11: 35,672,508 (GRCm39) V304M probably benign Het
Phf3 G A 1: 30,844,729 (GRCm39) T1410I probably benign Het
Ppm1k A G 6: 57,502,142 (GRCm39) I7T possibly damaging Het
Ppp1r12c T C 7: 4,500,424 (GRCm39) D73G probably damaging Het
Prelid2 T G 18: 42,014,332 (GRCm39) M165L probably benign Het
Prkd3 A C 17: 79,260,125 (GRCm39) L826R probably damaging Het
Ptchd4 A T 17: 42,814,433 (GRCm39) N778I probably damaging Het
Ptprm T C 17: 67,000,866 (GRCm39) D1063G possibly damaging Het
Rab27a C A 9: 72,982,764 (GRCm39) T23N probably damaging Het
Rasgrf2 A T 13: 92,044,205 (GRCm39) F949L probably benign Het
Rbm33 A G 5: 28,542,002 (GRCm39) N68D probably damaging Het
Rgl1 A T 1: 152,462,284 (GRCm39) L109Q probably damaging Het
Rnf20 A G 4: 49,638,197 (GRCm39) N103S possibly damaging Het
Sbno1 G A 5: 124,530,675 (GRCm39) L875F probably damaging Het
Scube1 T A 15: 83,512,277 (GRCm39) probably null Het
Selenbp1 G A 3: 94,844,669 (GRCm39) V109M probably damaging Het
Serpina3c T A 12: 104,117,805 (GRCm39) I178F probably damaging Het
Shisa8 C T 15: 82,092,702 (GRCm39) G63D probably damaging Het
Snx14 T C 9: 88,284,277 (GRCm39) R464G possibly damaging Het
Snx25 A T 8: 46,577,119 (GRCm39) M1K probably null Het
Sorcs3 C A 19: 48,694,448 (GRCm39) T574K possibly damaging Het
Syne2 A G 12: 76,150,557 (GRCm39) E6528G probably damaging Het
Syt5 T C 7: 4,543,245 (GRCm39) E338G probably damaging Het
Tbk1 T C 10: 121,387,223 (GRCm39) K691E probably benign Het
Tenm3 G A 8: 48,848,611 (GRCm39) T11I probably damaging Het
Thrb A G 14: 18,002,597 (GRCm38) H87R probably damaging Het
Tlr4 T A 4: 66,757,933 (GRCm39) M242K possibly damaging Het
Tm4sf19 T C 16: 32,224,820 (GRCm39) M56T possibly damaging Het
Tmem212 T A 3: 27,940,620 (GRCm39) R66* probably null Het
Tmem39b G T 4: 129,578,275 (GRCm39) D315E probably benign Het
Tnxb T C 17: 34,937,612 (GRCm39) F3834L probably damaging Het
Trim36 A T 18: 46,319,250 (GRCm39) L225* probably null Het
Trim42 A T 9: 97,247,732 (GRCm39) H321Q probably damaging Het
Trio G T 15: 27,732,726 (GRCm39) Q3052K probably benign Het
Trpm3 T C 19: 22,955,698 (GRCm39) I1091T probably benign Het
Tst T C 15: 78,284,143 (GRCm39) E228G possibly damaging Het
Ttn T C 2: 76,702,060 (GRCm39) probably benign Het
Uap1 A C 1: 169,978,510 (GRCm39) probably null Het
Ush2a T C 1: 188,530,011 (GRCm39) S3267P possibly damaging Het
Usp5 T C 6: 124,802,129 (GRCm39) T38A probably benign Het
Uvssa A T 5: 33,545,152 (GRCm39) Q84L probably damaging Het
Vmn1r159 T G 7: 22,542,693 (GRCm39) H113P probably damaging Het
Vps13d A T 4: 144,824,742 (GRCm39) probably null Het
Zfp182 T A X: 20,897,799 (GRCm39) I166L probably benign Het
Zfp811 A T 17: 33,016,622 (GRCm39) Y472N probably damaging Het
Other mutations in Or2ag15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Or2ag15 APN 7 106,340,908 (GRCm39) missense probably benign 0.20
IGL00937:Or2ag15 APN 7 106,340,364 (GRCm39) missense probably damaging 1.00
IGL01368:Or2ag15 APN 7 106,340,829 (GRCm39) missense probably benign 0.19
IGL01410:Or2ag15 APN 7 106,340,706 (GRCm39) missense probably benign 0.19
IGL01415:Or2ag15 APN 7 106,340,706 (GRCm39) missense probably benign 0.19
IGL01962:Or2ag15 APN 7 106,340,991 (GRCm39) missense probably benign 0.12
IGL02654:Or2ag15 APN 7 106,340,555 (GRCm39) nonsense probably null
IGL02903:Or2ag15 APN 7 106,340,917 (GRCm39) missense probably damaging 1.00
IGL03347:Or2ag15 APN 7 106,340,177 (GRCm39) utr 3 prime probably benign
IGL03391:Or2ag15 APN 7 106,340,962 (GRCm39) missense probably damaging 1.00
R0139:Or2ag15 UTSW 7 106,340,832 (GRCm39) missense probably benign 0.05
R0142:Or2ag15 UTSW 7 106,340,972 (GRCm39) missense probably benign 0.36
R1293:Or2ag15 UTSW 7 106,341,058 (GRCm39) missense probably damaging 0.98
R1715:Or2ag15 UTSW 7 106,340,755 (GRCm39) missense probably damaging 1.00
R1959:Or2ag15 UTSW 7 106,340,601 (GRCm39) missense probably damaging 1.00
R1960:Or2ag15 UTSW 7 106,340,601 (GRCm39) missense probably damaging 1.00
R2031:Or2ag15 UTSW 7 106,341,105 (GRCm39) missense probably damaging 1.00
R4790:Or2ag15 UTSW 7 106,340,998 (GRCm39) missense probably benign 0.05
R5550:Or2ag15 UTSW 7 106,340,340 (GRCm39) missense probably benign 0.01
R6232:Or2ag15 UTSW 7 106,340,761 (GRCm39) missense probably damaging 0.96
R6293:Or2ag15 UTSW 7 106,340,613 (GRCm39) missense probably damaging 1.00
R6643:Or2ag15 UTSW 7 106,340,911 (GRCm39) missense probably benign 0.06
R7831:Or2ag15 UTSW 7 106,340,620 (GRCm39) missense probably damaging 0.99
R8013:Or2ag15 UTSW 7 106,340,824 (GRCm39) missense probably benign 0.00
R8014:Or2ag15 UTSW 7 106,340,824 (GRCm39) missense probably benign 0.00
R8883:Or2ag15 UTSW 7 106,340,274 (GRCm39) missense possibly damaging 0.74
R9072:Or2ag15 UTSW 7 106,340,759 (GRCm39) nonsense probably null
RF018:Or2ag15 UTSW 7 106,340,692 (GRCm39) missense probably benign 0.02
X0020:Or2ag15 UTSW 7 106,340,343 (GRCm39) missense probably damaging 0.97
Z1088:Or2ag15 UTSW 7 106,340,350 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ACTCATGGCACCAGTCAGAGCATC -3'
(R):5'- AGCAGGAAGAAAGCCCTTGTTACC -3'

Sequencing Primer
(F):5'- CCAGTCAGAGCATCTATACTGTTG -3'
(R):5'- GAAGAAAGCCCTTGTTACCTGTTC -3'
Posted On 2014-04-13