Mutagenetix > Incidental Mutation

Incidental Mutation 'R1522:Tenm3'

167529

Institutional Source

Beutler Lab

Gene Symbol

Tenm3

Ensembl Gene

ENSMUSG00000031561

Gene Name

teneurin transmembrane protein 3

Synonyms

Ten-m3, Odz3, 2610100B16Rik

MMRRC Submission

040871-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.755) question?

Stock #

R1522 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

48227682-48843951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 48395576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 11 (T11I)

Ref Sequence

ENSEMBL: ENSMUSP00000105975 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000110343] [ENSMUST00000110345] [ENSMUST00000110346] [ENSMUST00000190840] [ENSMUST00000211976]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033965
AA Change: T283I

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: T283I

Domain	Start	End	E-Value	Type
Pfam:Ten_N	11	177	6.9e-91	PFAM
Pfam:Ten_N	171	308	1e-72	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2631	2708	1.5e-34	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110343
AA Change: T11I

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000105972
Gene: ENSMUSG00000031561
AA Change: T11I

Domain	Start	End	E-Value	Type
Pfam:Ten_N	1	36	2.3e-15	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110345
AA Change: T11I

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105974
Gene: ENSMUSG00000031561
AA Change: T11I

Domain	Start	End	E-Value	Type
Pfam:Ten_N	1	36	2.3e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110346
AA Change: T11I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105975
Gene: ENSMUSG00000031561
AA Change: T11I

Domain	Start	End	E-Value	Type
Pfam:Ten_N	1	36	1.1e-14	PFAM
transmembrane domain	37	59	N/A	INTRINSIC
EGF	245	273	2.32e-1	SMART
EGF_like	276	304	4.11e1	SMART
EGF	309	338	1.69e1	SMART
EGF	341	370	1.35e-2	SMART
EGF	375	405	6.11e-1	SMART
EGF	408	436	7.95e0	SMART
EGF	439	467	1.28e1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190840
AA Change: T283I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: T283I

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	182	7.6e-77	PFAM
Pfam:Ten_N	168	308	6.6e-50	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2630	2708	3.2e-35	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000211976
AA Change: T76I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	T	C	6: 83,162,586	S498P	probably damaging	Het
3100002H09Rik	A	G	4: 124,610,694	W22R	probably damaging	Het
AA986860	A	G	1: 130,743,094	E351G	probably damaging	Het
Acsl5	T	C	19: 55,280,492	V195A	probably benign	Het
Adamts10	A	G	17: 33,537,319	D312G	probably benign	Het
Adgrb1	A	G	15: 74,580,617	M211V	probably damaging	Het
Ankfy1	C	T	11: 72,755,867	R859*	probably null	Het
Atp8b1	T	A	18: 64,550,432	I742L	probably benign	Het
B3galnt2	T	A	13: 13,970,769	V89E	probably damaging	Het
BC024978	A	G	7: 27,202,680	H244R	probably damaging	Het
Brinp3	A	C	1: 146,901,890	T692P	probably damaging	Het
C9	T	A	15: 6,486,762	F349I	probably damaging	Het
Cacna1a	T	A	8: 84,633,433	M1976K	probably benign	Het
Ccdc180	T	C	4: 45,927,975	V1170A	possibly damaging	Het
Celsr1	A	G	15: 85,931,276	V1846A	probably benign	Het
Ces1f	A	T	8: 93,271,889	Y160N	possibly damaging	Het
Cfap45	A	G	1: 172,540,572	E377G	probably damaging	Het
Clca3a1	T	A	3: 144,755,171	M240L	probably benign	Het
Clnk	G	A	5: 38,794,966	T10M	probably damaging	Het
Cntrl	T	A	2: 35,155,279	I781K	possibly damaging	Het
Col11a2	G	A	17: 34,055,254	G375S	probably damaging	Het
Col6a5	T	A	9: 105,939,994	I373F	unknown	Het
Dmxl1	C	T	18: 49,852,367	A227V	probably benign	Het
Dok5	A	G	2: 170,732,132	N4D	probably benign	Het
Dpysl3	A	T	18: 43,363,557	V138D	probably damaging	Het
Efs	A	T	14: 54,919,715	Y380N	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Farp2	A	G	1: 93,618,553	Q855R	possibly damaging	Het
Fcrls	A	C	3: 87,256,707	S372A	possibly damaging	Het
Gadl1	C	T	9: 115,944,229	A113V	probably damaging	Het
Gatsl2	T	G	5: 134,125,887	S43R	probably damaging	Het
Gda	T	A	19: 21,412,539	E219D	probably benign	Het
Gli1	A	T	10: 127,332,577	M469K	probably damaging	Het
Gm4847	A	T	1: 166,641,650	S148R	probably damaging	Het
Golga2	T	C	2: 32,302,204	V325A	probably benign	Het
Hpf1	A	G	8: 60,896,749	D137G	probably damaging	Het
Htr2a	C	G	14: 74,705,853	S291*	probably null	Het
Itga5	G	A	15: 103,356,782	Q233*	probably null	Het
Jazf1	C	A	6: 52,812,183	R102L	probably damaging	Het
Kif6	T	G	17: 49,714,113	L322R	probably damaging	Het
Ktn1	A	C	14: 47,667,416	K217T	probably damaging	Het
Lig4	A	T	8: 9,973,012	V256E	possibly damaging	Het
Lrp1	G	T	10: 127,567,364	D2113E	probably damaging	Het
Lrp1	A	T	10: 127,575,286	D1399E	probably benign	Het
Mmel1	A	G	4: 154,894,986	E717G	probably damaging	Het
Mndal	G	T	1: 173,871,466	P155H	possibly damaging	Het
Mycbpap	A	G	11: 94,511,623		probably null	Het
Nedd1	T	C	10: 92,719,614	E3G	probably damaging	Het
Nlgn1	A	T	3: 25,435,909	N551K	probably damaging	Het
Nup210	G	A	6: 91,069,166	P595L	possibly damaging	Het
Olfr117	A	T	17: 37,659,770	C188S	probably damaging	Het
Olfr1302	A	T	2: 111,780,348		probably null	Het
Olfr199	T	G	16: 59,215,984	T210P	probably damaging	Het
Olfr477	A	G	7: 107,990,533	H56R	probably benign	Het
Olfr697	A	G	7: 106,741,005	C310R	probably benign	Het
Pank3	G	A	11: 35,781,681	V304M	probably benign	Het
Phf3	G	A	1: 30,805,648	T1410I	probably benign	Het
Ppm1k	A	G	6: 57,525,157	I7T	possibly damaging	Het
Ppp1r12c	T	C	7: 4,497,425	D73G	probably damaging	Het
Prelid2	T	G	18: 41,881,267	M165L	probably benign	Het
Prkd3	A	C	17: 78,952,696	L826R	probably damaging	Het
Ptchd4	A	T	17: 42,503,542	N778I	probably damaging	Het
Ptprm	T	C	17: 66,693,871	D1063G	possibly damaging	Het
Rab27a	C	A	9: 73,075,482	T23N	probably damaging	Het
Rasgrf2	A	T	13: 91,896,086	F949L	probably benign	Het
Rbm33	A	G	5: 28,337,004	N68D	probably damaging	Het
Rgl1	A	T	1: 152,586,533	L109Q	probably damaging	Het
Rnf20	A	G	4: 49,638,197	N103S	possibly damaging	Het
Sbno1	G	A	5: 124,392,612	L875F	probably damaging	Het
Scube1	T	A	15: 83,628,076		probably null	Het
Selenbp1	G	A	3: 94,937,358	V109M	probably damaging	Het
Serpina3c	T	A	12: 104,151,546	I178F	probably damaging	Het
Shisa8	C	T	15: 82,208,501	G63D	probably damaging	Het
Snx14	T	C	9: 88,402,224	R464G	possibly damaging	Het
Snx25	A	T	8: 46,124,082	M1K	probably null	Het
Sorcs3	C	A	19: 48,706,009	T574K	possibly damaging	Het
Syne2	A	G	12: 76,103,783	E6528G	probably damaging	Het
Syt5	T	C	7: 4,540,246	E338G	probably damaging	Het
Tbk1	T	C	10: 121,551,318	K691E	probably benign	Het
Thrb	A	G	14: 18,002,597	H87R	probably damaging	Het
Tlr4	T	A	4: 66,839,696	M242K	possibly damaging	Het
Tm4sf19	T	C	16: 32,406,002	M56T	possibly damaging	Het
Tmem212	T	A	3: 27,886,471	R66*	probably null	Het
Tmem39b	G	T	4: 129,684,482	D315E	probably benign	Het
Tnxb	T	C	17: 34,718,638	F3834L	probably damaging	Het
Trim36	A	T	18: 46,186,183	L225*	probably null	Het
Trim42	A	T	9: 97,365,679	H321Q	probably damaging	Het
Trio	G	T	15: 27,732,640	Q3052K	probably benign	Het
Trpm3	T	C	19: 22,978,334	I1091T	probably benign	Het
Tst	T	C	15: 78,399,943	E228G	possibly damaging	Het
Ttn	T	C	2: 76,871,716		probably benign	Het
Uap1	A	C	1: 170,150,941		probably null	Het
Ush2a	T	C	1: 188,797,814	S3267P	possibly damaging	Het
Usp5	T	C	6: 124,825,166	T38A	probably benign	Het
Uvssa	A	T	5: 33,387,808	Q84L	probably damaging	Het
Vmn1r159	T	G	7: 22,843,268	H113P	probably damaging	Het
Vps13d	A	T	4: 145,098,172		probably null	Het
Zfp182	T	A	X: 21,031,560	I166L	probably benign	Het
Zfp811	A	T	17: 32,797,648	Y472N	probably damaging	Het

Other mutations in Tenm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Tenm3	APN	8	48417060	missense	probably damaging	1.00
IGL00538:Tenm3	APN	8	48236025	missense	probably damaging	1.00
IGL00719:Tenm3	APN	8	48279042	missense	probably benign	0.39
IGL00720:Tenm3	APN	8	48276421	missense	probably damaging	0.98
IGL00870:Tenm3	APN	8	48417132	missense	probably benign	0.00
IGL00976:Tenm3	APN	8	48256841	missense	probably benign	0.14
IGL01469:Tenm3	APN	8	48236423	missense	probably damaging	1.00
IGL01508:Tenm3	APN	8	48276645	missense	probably benign	0.09
IGL01590:Tenm3	APN	8	48228802	missense	probably damaging	1.00
IGL01610:Tenm3	APN	8	48254477	missense	probably damaging	1.00
IGL01874:Tenm3	APN	8	48236758	nonsense	probably null
IGL01892:Tenm3	APN	8	48276396	missense	probably benign	0.09
IGL02098:Tenm3	APN	8	48276576	missense	possibly damaging	0.94
IGL02382:Tenm3	APN	8	48235476	missense	probably damaging	1.00
IGL02397:Tenm3	APN	8	48236694	missense	possibly damaging	0.94
IGL02475:Tenm3	APN	8	48279198	splice site	probably benign
IGL02502:Tenm3	APN	8	48288016	missense	probably damaging	1.00
IGL02508:Tenm3	APN	8	48299639	missense	probably benign	0.30
IGL02543:Tenm3	APN	8	48298956	missense	probably damaging	1.00
IGL02723:Tenm3	APN	8	48276903	missense	probably benign	0.02
IGL03037:Tenm3	APN	8	48298878	missense	possibly damaging	0.90
IGL03160:Tenm3	APN	8	48646418	missense	probably benign	0.05
IGL03268:Tenm3	APN	8	48235523	missense	probably damaging	1.00
IGL02988:Tenm3	UTSW	8	48235346	missense	probably damaging	0.99
PIT4431001:Tenm3	UTSW	8	48235607	missense	probably damaging	1.00
PIT4504001:Tenm3	UTSW	8	48293657	missense	probably damaging	1.00
R0079:Tenm3	UTSW	8	48343345	missense	possibly damaging	0.90
R0121:Tenm3	UTSW	8	48342659	missense	probably damaging	0.99
R0123:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0134:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0147:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0148:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0309:Tenm3	UTSW	8	48341034	missense	probably damaging	1.00
R0322:Tenm3	UTSW	8	48236912	splice site	probably benign
R0335:Tenm3	UTSW	8	48232105	missense	probably damaging	1.00
R0355:Tenm3	UTSW	8	48228975	missense	probably damaging	1.00
R0411:Tenm3	UTSW	8	48287791	missense	possibly damaging	0.61
R0505:Tenm3	UTSW	8	48341160	splice site	probably benign
R0573:Tenm3	UTSW	8	48674399	splice site	probably benign
R0599:Tenm3	UTSW	8	48277710	missense	probably damaging	1.00
R0616:Tenm3	UTSW	8	48276156	missense	possibly damaging	0.76
R0637:Tenm3	UTSW	8	48236525	missense	probably damaging	1.00
R0726:Tenm3	UTSW	8	48236594	missense	probably damaging	1.00
R0840:Tenm3	UTSW	8	48335742	missense	probably damaging	0.99
R0981:Tenm3	UTSW	8	48298965	missense	probably damaging	1.00
R1006:Tenm3	UTSW	8	48228542	missense	probably damaging	1.00
R1199:Tenm3	UTSW	8	48235582	missense	probably damaging	0.99
R1223:Tenm3	UTSW	8	48240396	missense	possibly damaging	0.72
R1240:Tenm3	UTSW	8	48287893	missense	possibly damaging	0.74
R1394:Tenm3	UTSW	8	48276400	missense	probably benign
R1455:Tenm3	UTSW	8	48279048	missense	possibly damaging	0.87
R1459:Tenm3	UTSW	8	48235971	missense	probably damaging	1.00
R1473:Tenm3	UTSW	8	48310625	missense	probably damaging	1.00
R1501:Tenm3	UTSW	8	48343316	missense	probably damaging	0.99
R1507:Tenm3	UTSW	8	48287822	missense	probably benign	0.01
R1524:Tenm3	UTSW	8	48228981	missense	possibly damaging	0.92
R1553:Tenm3	UTSW	8	48236421	missense	probably damaging	1.00
R1572:Tenm3	UTSW	8	48228993	missense	possibly damaging	0.94
R1583:Tenm3	UTSW	8	48279074	missense	probably benign	0.09
R1676:Tenm3	UTSW	8	48417119	missense	possibly damaging	0.83
R1732:Tenm3	UTSW	8	48310634	missense	probably damaging	1.00
R1768:Tenm3	UTSW	8	48232104	missense	probably damaging	1.00
R1777:Tenm3	UTSW	8	48417179	missense	probably benign	0.05
R1793:Tenm3	UTSW	8	48674544	missense	probably damaging	0.98
R1801:Tenm3	UTSW	8	48276256	missense	probably benign	0.39
R1863:Tenm3	UTSW	8	48276346	missense	probably benign	0.20
R1898:Tenm3	UTSW	8	48310761	missense	probably damaging	1.00
R1971:Tenm3	UTSW	8	48236313	missense	probably damaging	1.00
R1972:Tenm3	UTSW	8	48228591	missense	probably damaging	1.00
R1996:Tenm3	UTSW	8	48228668	missense	probably damaging	1.00
R2061:Tenm3	UTSW	8	48342256	critical splice donor site	probably null
R2109:Tenm3	UTSW	8	48343349	missense	possibly damaging	0.94
R2124:Tenm3	UTSW	8	48417006	critical splice donor site	probably null
R2190:Tenm3	UTSW	8	48395544	missense	probably damaging	1.00
R2204:Tenm3	UTSW	8	48674550	missense	probably benign	0.17
R2233:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2234:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2235:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2237:Tenm3	UTSW	8	48342337	missense	probably damaging	1.00
R2418:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2419:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2435:Tenm3	UTSW	8	48287953	missense	probably damaging	1.00
R2483:Tenm3	UTSW	8	48240270	missense	probably damaging	0.99
R3406:Tenm3	UTSW	8	48228555	missense	probably damaging	1.00
R3724:Tenm3	UTSW	8	48277746	missense	probably damaging	0.97
R4009:Tenm3	UTSW	8	48349223	missense	probably damaging	1.00
R4210:Tenm3	UTSW	8	48349404	missense	probably damaging	1.00
R4293:Tenm3	UTSW	8	48395658	missense	probably damaging	1.00
R4656:Tenm3	UTSW	8	48293726	missense	probably damaging	1.00
R4663:Tenm3	UTSW	8	48235970	missense	probably damaging	1.00
R4835:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R4851:Tenm3	UTSW	8	48310621	critical splice donor site	probably null
R4867:Tenm3	UTSW	8	48235821	missense	probably damaging	1.00
R4892:Tenm3	UTSW	8	48276861	missense	probably damaging	0.99
R4895:Tenm3	UTSW	8	48300971	missense	probably damaging	1.00
R4962:Tenm3	UTSW	8	48278961	nonsense	probably null
R4995:Tenm3	UTSW	8	48229137	missense	possibly damaging	0.87
R4996:Tenm3	UTSW	8	48235826	missense	probably damaging	0.97
R5091:Tenm3	UTSW	8	48342308	missense	probably benign	0.14
R5228:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5253:Tenm3	UTSW	8	48229198	missense	possibly damaging	0.92
R5260:Tenm3	UTSW	8	48236855	missense	probably damaging	1.00
R5363:Tenm3	UTSW	8	48287831	missense	possibly damaging	0.55
R5414:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5427:Tenm3	UTSW	8	48236564	missense	probably damaging	1.00
R5431:Tenm3	UTSW	8	48367377	nonsense	probably null
R5566:Tenm3	UTSW	8	48279006	missense	probably damaging	1.00
R5579:Tenm3	UTSW	8	48236764	missense	probably damaging	1.00
R5656:Tenm3	UTSW	8	48228762	missense	probably damaging	1.00
R5931:Tenm3	UTSW	8	48646498	missense	probably benign	0.00
R5959:Tenm3	UTSW	8	48646447	nonsense	probably null
R5965:Tenm3	UTSW	8	48228508	nonsense	probably null
R6062:Tenm3	UTSW	8	48343406	missense	possibly damaging	0.46
R6151:Tenm3	UTSW	8	48395573	missense	probably damaging	1.00
R6157:Tenm3	UTSW	8	48298808	missense	probably damaging	0.96
R6167:Tenm3	UTSW	8	48254622	missense	possibly damaging	0.46
R6217:Tenm3	UTSW	8	48293665	missense	probably damaging	0.99
R6233:Tenm3	UTSW	8	48417059	missense	probably damaging	1.00
R6270:Tenm3	UTSW	8	48367394	missense	probably damaging	0.98
R6329:Tenm3	UTSW	8	48276849	missense	probably damaging	0.99
R6466:Tenm3	UTSW	8	48236063	missense	probably damaging	0.97
R6515:Tenm3	UTSW	8	48417222	missense	probably benign
R6516:Tenm3	UTSW	8	48417222	missense	probably benign
R6747:Tenm3	UTSW	8	48343243	missense	probably damaging	1.00
R6782:Tenm3	UTSW	8	48646256	critical splice donor site	probably null
R6788:Tenm3	UTSW	8	48674493	missense	probably damaging	1.00
R6823:Tenm3	UTSW	8	48256837	missense	probably damaging	0.99
R6846:Tenm3	UTSW	8	48276738	missense	probably benign	0.39
R6913:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R6941:Tenm3	UTSW	8	48674416	missense	probably damaging	0.99
R6950:Tenm3	UTSW	8	48240479	nonsense	probably null
R6968:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6970:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6993:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R7003:Tenm3	UTSW	8	48240444	missense	probably damaging	1.00
R7125:Tenm3	UTSW	8	48674553	missense	probably benign	0.00
R7140:Tenm3	UTSW	8	48292236	missense	probably damaging	1.00
R7222:Tenm3	UTSW	8	48300969	missense	probably damaging	1.00
R7232:Tenm3	UTSW	8	48235935	missense	probably damaging	1.00
R7336:Tenm3	UTSW	8	48236177	missense	possibly damaging	0.93
R7417:Tenm3	UTSW	8	48236183	missense	probably damaging	1.00
R7526:Tenm3	UTSW	8	48287812	missense	probably damaging	0.96
R7527:Tenm3	UTSW	8	48276600	missense	possibly damaging	0.60
R7616:Tenm3	UTSW	8	48341049	missense	possibly damaging	0.56
R7662:Tenm3	UTSW	8	48335727	missense	probably benign	0.27
R7734:Tenm3	UTSW	8	48646333	missense	probably damaging	1.00
R7802:Tenm3	UTSW	8	48236465	missense	probably damaging	1.00
R7812:Tenm3	UTSW	8	48276300	missense	probably benign	0.01
R7843:Tenm3	UTSW	8	48229111	nonsense	probably null
R7951:Tenm3	UTSW	8	48310703	missense	possibly damaging	0.86
R8293:Tenm3	UTSW	8	48367422	missense	possibly damaging	0.91
R8336:Tenm3	UTSW	8	48293773	missense	probably damaging	1.00
R8351:Tenm3	UTSW	8	48287872	missense	probably damaging	0.96
R8387:Tenm3	UTSW	8	48287848	missense	probably damaging	0.98
R8414:Tenm3	UTSW	8	48293509	missense	probably damaging	1.00
R8451:Tenm3	UTSW	8	48287872	missense	probably damaging	0.96
R8465:Tenm3	UTSW	8	48229181	missense	probably damaging	1.00
R8528:Tenm3	UTSW	8	48342633	missense	probably damaging	1.00
R8717:Tenm3	UTSW	8	48299645	missense	possibly damaging	0.77
R8734:Tenm3	UTSW	8	48349356	missense	probably benign	0.16
R8781:Tenm3	UTSW	8	48342449	frame shift	probably null
R8820:Tenm3	UTSW	8	48310724	missense	probably damaging	0.96
R8821:Tenm3	UTSW	8	48276382	missense
R8831:Tenm3	UTSW	8	48276382	missense
R8853:Tenm3	UTSW	8	48342347	missense	probably damaging	1.00
R8900:Tenm3	UTSW	8	48236402	missense	probably damaging	1.00
R8931:Tenm3	UTSW	8	48235602	missense	probably damaging	1.00
R8933:Tenm3	UTSW	8	48279060	missense	possibly damaging	0.53
R8989:Tenm3	UTSW	8	48235348	nonsense	probably null
R8998:Tenm3	UTSW	8	48276687	missense	probably damaging	1.00
R9008:Tenm3	UTSW	8	48342653	missense	probably damaging	0.98
R9017:Tenm3	UTSW	8	48254633	missense	probably damaging	0.99
R9101:Tenm3	UTSW	8	48292151	missense	probably damaging	1.00
R9108:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R9142:Tenm3	UTSW	8	48335513	missense	unknown
R9231:Tenm3	UTSW	8	48236196	missense	probably damaging	1.00
R9309:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R9310:Tenm3	UTSW	8	48555900	unclassified	probably benign
R9336:Tenm3	UTSW	8	48417080	missense	probably damaging	1.00
R9373:Tenm3	UTSW	8	48299655	missense	probably damaging	1.00
R9393:Tenm3	UTSW	8	48674524	missense	probably damaging	0.99
R9509:Tenm3	UTSW	8	48313257	nonsense	probably null
R9575:Tenm3	UTSW	8	48235761	missense	possibly damaging	0.94
R9698:Tenm3	UTSW	8	48236211	missense	probably damaging	1.00
R9722:Tenm3	UTSW	8	48300814	missense	probably benign	0.00
R9788:Tenm3	UTSW	8	48335561	missense	probably benign	0.02
X0010:Tenm3	UTSW	8	48287829	missense	probably damaging	0.98
X0025:Tenm3	UTSW	8	48236477	missense	probably damaging	1.00
Z1177:Tenm3	UTSW	8	48276780	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- gactaagacaTCTACCAAGCAAGTTTTCCT -3'
(R):5'- GCACCTacacacacacacacaca -3'

Sequencing Primer
(F):5'- GCATTGGTTTACAAGCAAAATGGC -3'
(R):5'- gaaggagggagggaggg -3'

Posted On

2014-04-13