Mutagenetix > Incidental Mutations

Incidental Mutation 'R1522:Snx14'

167536

Institutional Source

Beutler Lab

Gene Symbol

Snx14

Ensembl Gene

ENSMUSG00000032422

Gene Name

sorting nexin 14

Synonyms

C330035N22Rik, YR-14

MMRRC Submission

040871-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1522 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88376750-88438958 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88402224 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 464 (R464G)

Ref Sequence

ENSEMBL: ENSMUSP00000130116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000126405] [ENSMUST00000165315] [ENSMUST00000173011] [ENSMUST00000173039] [ENSMUST00000174806]

Predicted Effect

probably benign
Transcript: ENSMUST00000126405

SMART Domains

Protein: ENSMUSP00000116773
Gene: ENSMUSG00000032422

Domain	Start	End	E-Value	Type
transmembrane domain	57	76	N/A	INTRINSIC
transmembrane domain	80	102	N/A	INTRINSIC
Pfam:PXA	157	210	3.9e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140439

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165315
AA Change: R464G

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000130116
Gene: ENSMUSG00000032422
AA Change: R464G

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	157	330	8.2e-49	PFAM
Pfam:RGS	363	495	4.3e-13	PFAM
PX	585	704	8.77e-13	SMART
low complexity region	771	785	N/A	INTRINSIC
Pfam:Nexin_C	825	930	2e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173011

SMART Domains

Protein: ENSMUSP00000133507
Gene: ENSMUSG00000032422

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	157	330	3.1e-49	PFAM
Pfam:RGS	363	482	3.1e-9	PFAM
low complexity region	499	513	N/A	INTRINSIC
Pfam:Nexin_C	553	658	7.2e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173039
AA Change: R420G

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000133624
Gene: ENSMUSG00000032422
AA Change: R420G

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	154	286	6.5e-33	PFAM
Pfam:RGS	319	451	2.6e-13	PFAM
PX	541	660	8.77e-13	SMART
low complexity region	727	741	N/A	INTRINSIC
Pfam:Nexin_C	781	886	1.1e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174806
AA Change: R464G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000133533
Gene: ENSMUSG00000032422
AA Change: R464G

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	158	327	1.9e-44	PFAM
Pfam:RGS	363	495	1.3e-13	PFAM
PX	594	713	8.77e-13	SMART
low complexity region	780	794	N/A	INTRINSIC
Pfam:Nexin_C	834	938	2.8e-18	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family have a phox (PX) phosphoinositide binding domain and are involved in intracellular trafficking. The encoded protein also contains a regulator of G protein signaling (RGS) domain. Regulator of G protein signaling family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. Alternate splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	T	C	6: 83,162,586	S498P	probably damaging	Het
3100002H09Rik	A	G	4: 124,610,694	W22R	probably damaging	Het
AA986860	A	G	1: 130,743,094	E351G	probably damaging	Het
Acsl5	T	C	19: 55,280,492	V195A	probably benign	Het
Adamts10	A	G	17: 33,537,319	D312G	probably benign	Het
Adgrb1	A	G	15: 74,580,617	M211V	probably damaging	Het
Ankfy1	C	T	11: 72,755,867	R859*	probably null	Het
Atp8b1	T	A	18: 64,550,432	I742L	probably benign	Het
B3galnt2	T	A	13: 13,970,769	V89E	probably damaging	Het
BC024978	A	G	7: 27,202,680	H244R	probably damaging	Het
Brinp3	A	C	1: 146,901,890	T692P	probably damaging	Het
C9	T	A	15: 6,486,762	F349I	probably damaging	Het
Cacna1a	T	A	8: 84,633,433	M1976K	probably benign	Het
Ccdc180	T	C	4: 45,927,975	V1170A	possibly damaging	Het
Celsr1	A	G	15: 85,931,276	V1846A	probably benign	Het
Ces1f	A	T	8: 93,271,889	Y160N	possibly damaging	Het
Cfap45	A	G	1: 172,540,572	E377G	probably damaging	Het
Clca3a1	T	A	3: 144,755,171	M240L	probably benign	Het
Clnk	G	A	5: 38,794,966	T10M	probably damaging	Het
Cntrl	T	A	2: 35,155,279	I781K	possibly damaging	Het
Col11a2	G	A	17: 34,055,254	G375S	probably damaging	Het
Col6a5	T	A	9: 105,939,994	I373F	unknown	Het
Dmxl1	C	T	18: 49,852,367	A227V	probably benign	Het
Dok5	A	G	2: 170,732,132	N4D	probably benign	Het
Dpysl3	A	T	18: 43,363,557	V138D	probably damaging	Het
Efs	A	T	14: 54,919,715	Y380N	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Farp2	A	G	1: 93,618,553	Q855R	possibly damaging	Het
Fcrls	A	C	3: 87,256,707	S372A	possibly damaging	Het
Gadl1	C	T	9: 115,944,229	A113V	probably damaging	Het
Gatsl2	T	G	5: 134,125,887	S43R	probably damaging	Het
Gda	T	A	19: 21,412,539	E219D	probably benign	Het
Gli1	A	T	10: 127,332,577	M469K	probably damaging	Het
Gm4847	A	T	1: 166,641,650	S148R	probably damaging	Het
Golga2	T	C	2: 32,302,204	V325A	probably benign	Het
Hpf1	A	G	8: 60,896,749	D137G	probably damaging	Het
Htr2a	C	G	14: 74,705,853	S291*	probably null	Het
Itga5	G	A	15: 103,356,782	Q233*	probably null	Het
Jazf1	C	A	6: 52,812,183	R102L	probably damaging	Het
Kif6	T	G	17: 49,714,113	L322R	probably damaging	Het
Ktn1	A	C	14: 47,667,416	K217T	probably damaging	Het
Lig4	A	T	8: 9,973,012	V256E	possibly damaging	Het
Lrp1	G	T	10: 127,567,364	D2113E	probably damaging	Het
Lrp1	A	T	10: 127,575,286	D1399E	probably benign	Het
Mmel1	A	G	4: 154,894,986	E717G	probably damaging	Het
Mndal	G	T	1: 173,871,466	P155H	possibly damaging	Het
Mycbpap	A	G	11: 94,511,623		probably null	Het
Nedd1	T	C	10: 92,719,614	E3G	probably damaging	Het
Nlgn1	A	T	3: 25,435,909	N551K	probably damaging	Het
Nup210	G	A	6: 91,069,166	P595L	possibly damaging	Het
Olfr117	A	T	17: 37,659,770	C188S	probably damaging	Het
Olfr1302	A	T	2: 111,780,348		probably null	Het
Olfr199	T	G	16: 59,215,984	T210P	probably damaging	Het
Olfr477	A	G	7: 107,990,533	H56R	probably benign	Het
Olfr697	A	G	7: 106,741,005	C310R	probably benign	Het
Pank3	G	A	11: 35,781,681	V304M	probably benign	Het
Phf3	G	A	1: 30,805,648	T1410I	probably benign	Het
Ppm1k	A	G	6: 57,525,157	I7T	possibly damaging	Het
Ppp1r12c	T	C	7: 4,497,425	D73G	probably damaging	Het
Prelid2	T	G	18: 41,881,267	M165L	probably benign	Het
Prkd3	A	C	17: 78,952,696	L826R	probably damaging	Het
Ptchd4	A	T	17: 42,503,542	N778I	probably damaging	Het
Ptprm	T	C	17: 66,693,871	D1063G	possibly damaging	Het
Rab27a	C	A	9: 73,075,482	T23N	probably damaging	Het
Rasgrf2	A	T	13: 91,896,086	F949L	probably benign	Het
Rbm33	A	G	5: 28,337,004	N68D	probably damaging	Het
Rgl1	A	T	1: 152,586,533	L109Q	probably damaging	Het
Rnf20	A	G	4: 49,638,197	N103S	possibly damaging	Het
Sbno1	G	A	5: 124,392,612	L875F	probably damaging	Het
Scube1	T	A	15: 83,628,076		probably null	Het
Selenbp1	G	A	3: 94,937,358	V109M	probably damaging	Het
Serpina3c	T	A	12: 104,151,546	I178F	probably damaging	Het
Shisa8	C	T	15: 82,208,501	G63D	probably damaging	Het
Snx25	A	T	8: 46,124,082	M1K	probably null	Het
Sorcs3	C	A	19: 48,706,009	T574K	possibly damaging	Het
Syne2	A	G	12: 76,103,783	E6528G	probably damaging	Het
Syt5	T	C	7: 4,540,246	E338G	probably damaging	Het
Tbk1	T	C	10: 121,551,318	K691E	probably benign	Het
Tenm3	G	A	8: 48,395,576	T11I	probably damaging	Het
Thrb	A	G	14: 18,002,597	H87R	probably damaging	Het
Tlr4	T	A	4: 66,839,696	M242K	possibly damaging	Het
Tm4sf19	T	C	16: 32,406,002	M56T	possibly damaging	Het
Tmem212	T	A	3: 27,886,471	R66*	probably null	Het
Tmem39b	G	T	4: 129,684,482	D315E	probably benign	Het
Tnxb	T	C	17: 34,718,638	F3834L	probably damaging	Het
Trim36	A	T	18: 46,186,183	L225*	probably null	Het
Trim42	A	T	9: 97,365,679	H321Q	probably damaging	Het
Trio	G	T	15: 27,732,640	Q3052K	probably benign	Het
Trpm3	T	C	19: 22,978,334	I1091T	probably benign	Het
Tst	T	C	15: 78,399,943	E228G	possibly damaging	Het
Ttn	T	C	2: 76,871,716		probably benign	Het
Uap1	A	C	1: 170,150,941		probably null	Het
Ush2a	T	C	1: 188,797,814	S3267P	possibly damaging	Het
Usp5	T	C	6: 124,825,166	T38A	probably benign	Het
Uvssa	A	T	5: 33,387,808	Q84L	probably damaging	Het
Vmn1r159	T	G	7: 22,843,268	H113P	probably damaging	Het
Vps13d	A	T	4: 145,098,172		probably null	Het
Zfp182	T	A	X: 21,031,560	I166L	probably benign	Het
Zfp811	A	T	17: 32,797,648	Y472N	probably damaging	Het

Other mutations in Snx14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Snx14	APN	9	88402190	missense	probably damaging	0.99
IGL00773:Snx14	APN	9	88394539	missense	probably damaging	0.96
IGL00847:Snx14	APN	9	88420329	missense	probably damaging	1.00
IGL01526:Snx14	APN	9	88381500	missense	probably damaging	0.99
IGL01662:Snx14	APN	9	88385838	splice site	probably benign
IGL01928:Snx14	APN	9	88381512	missense	probably benign	0.04
IGL02225:Snx14	APN	9	88413524	missense	probably damaging	0.99
IGL02498:Snx14	APN	9	88407464	missense	probably damaging	1.00
IGL02585:Snx14	APN	9	88404518	missense	possibly damaging	0.92
IGL02634:Snx14	APN	9	88403303	missense	probably damaging	1.00
IGL03073:Snx14	APN	9	88422896	critical splice donor site	probably null
R0167:Snx14	UTSW	9	88407416	missense	probably damaging	1.00
R0324:Snx14	UTSW	9	88405238	critical splice donor site	probably null
R0627:Snx14	UTSW	9	88394430	missense	probably benign
R0862:Snx14	UTSW	9	88383996	missense	possibly damaging	0.81
R0864:Snx14	UTSW	9	88383996	missense	possibly damaging	0.81
R0973:Snx14	UTSW	9	88400721	critical splice donor site	probably null
R0973:Snx14	UTSW	9	88400721	critical splice donor site	probably null
R0974:Snx14	UTSW	9	88400721	critical splice donor site	probably null
R1478:Snx14	UTSW	9	88394528	missense	probably benign	0.00
R1511:Snx14	UTSW	9	88398364	nonsense	probably null
R1612:Snx14	UTSW	9	88376905	missense	possibly damaging	0.81
R1634:Snx14	UTSW	9	88385739	missense	probably benign	0.00
R1634:Snx14	UTSW	9	88407490	splice site	probably benign
R1704:Snx14	UTSW	9	88413538	missense	probably damaging	1.00
R1713:Snx14	UTSW	9	88415675	missense	probably damaging	1.00
R1883:Snx14	UTSW	9	88402261	missense	probably benign	0.01
R3701:Snx14	UTSW	9	88420243	splice site	probably benign
R3853:Snx14	UTSW	9	88407319	splice site	probably benign
R4301:Snx14	UTSW	9	88410623	missense	probably damaging	1.00
R4449:Snx14	UTSW	9	88422999	missense	probably benign	0.05
R4793:Snx14	UTSW	9	88394442	missense	probably damaging	0.98
R4934:Snx14	UTSW	9	88398288	missense	probably damaging	0.98
R5126:Snx14	UTSW	9	88382099	missense	probably damaging	1.00
R5227:Snx14	UTSW	9	88398294	missense	possibly damaging	0.77
R5518:Snx14	UTSW	9	88383802	missense	probably damaging	1.00
R5838:Snx14	UTSW	9	88391776	missense	probably damaging	1.00
R5957:Snx14	UTSW	9	88403274	missense	possibly damaging	0.84
R6153:Snx14	UTSW	9	88391806	missense	probably damaging	1.00
R6156:Snx14	UTSW	9	88407339	missense	possibly damaging	0.92
R6703:Snx14	UTSW	9	88422914	missense	probably damaging	0.96
R6784:Snx14	UTSW	9	88381792	missense	probably benign	0.01
R6823:Snx14	UTSW	9	88394382	missense	possibly damaging	0.90
R6837:Snx14	UTSW	9	88380223	missense	probably benign	0.07
R7169:Snx14	UTSW	9	88398309	missense	probably damaging	0.98
R7216:Snx14	UTSW	9	88381791	missense	probably damaging	0.99
R7224:Snx14	UTSW	9	88394561	missense	possibly damaging	0.92
R7357:Snx14	UTSW	9	88404316	missense	possibly damaging	0.49
R7738:Snx14	UTSW	9	88407474	missense	probably benign	0.00
R7743:Snx14	UTSW	9	88398349	missense	probably benign	0.01
R7969:Snx14	UTSW	9	88413560	missense	probably damaging	1.00
R8016:Snx14	UTSW	9	88415687	missense	probably damaging	0.99
R8384:Snx14	UTSW	9	88403280	nonsense	probably null
R8492:Snx14	UTSW	9	88381816	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CGATTCTGCACCTCTTAAAAGTTGCCTA -3'
(R):5'- TCTCAGAGCTGGAGGTAAATCTTTCTCA -3'

Sequencing Primer
(F):5'- TGACATTGAAACACACTACTTTCTC -3'
(R):5'- GGAGGTAAATCTTTCTCATTTCCC -3'

Posted On

2014-04-13