Incidental Mutation 'R1522:Ktn1'
ID167556
Institutional Source Beutler Lab
Gene Symbol Ktn1
Ensembl Gene ENSMUSG00000021843
Gene Namekinectin 1
Synonyms
MMRRC Submission 040871-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1522 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location47648448-47739894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 47667416 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 217 (K217T)
Ref Sequence ENSEMBL: ENSMUSP00000139946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022391] [ENSMUST00000185343] [ENSMUST00000185940] [ENSMUST00000186466] [ENSMUST00000186627] [ENSMUST00000186761] [ENSMUST00000187039] [ENSMUST00000187262] [ENSMUST00000187839] [ENSMUST00000188330] [ENSMUST00000188553] [ENSMUST00000189101] [ENSMUST00000190535] [ENSMUST00000190999] [ENSMUST00000191446] [ENSMUST00000191511] [ENSMUST00000190252] [ENSMUST00000189533] [ENSMUST00000190182] [ENSMUST00000191018] [ENSMUST00000189986]
Predicted Effect probably damaging
Transcript: ENSMUST00000022391
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022391
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1267 N/A INTRINSIC
coiled coil region 1302 1326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185343
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140186
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185940
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139625
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
coiled coil region 1198 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186466
SMART Domains Protein: ENSMUSP00000140523
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
Pfam:Rib_recp_KP_reg 29 173 9.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186627
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140873
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186761
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139521
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187039
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140202
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
coiled coil region 1198 1222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187262
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140206
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187839
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140324
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1267 N/A INTRINSIC
coiled coil region 1302 1326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188330
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140845
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1187 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188553
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140865
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1216 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189101
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140178
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190535
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139952
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1244 N/A INTRINSIC
coiled coil region 1279 1303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190999
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139673
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1215 N/A INTRINSIC
coiled coil region 1250 1274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191446
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140748
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1215 N/A INTRINSIC
coiled coil region 1250 1274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191511
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139946
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1192 N/A INTRINSIC
coiled coil region 1227 1251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190252
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140011
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1210 N/A INTRINSIC
coiled coil region 1245 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189533
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140142
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1187 N/A INTRINSIC
coiled coil region 1222 1246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190182
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140301
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1238 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191018
AA Change: K217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139585
Gene: ENSMUSG00000021843
AA Change: K217T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1220 N/A INTRINSIC
coiled coil region 1255 1279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189986
SMART Domains Protein: ENSMUSP00000139970
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
Pfam:Rib_recp_KP_reg 29 172 2.1e-7 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation or a floxed allele exhibit no discernable phenotype; mice are viable and fertile up to one year of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik T C 6: 83,162,586 S498P probably damaging Het
3100002H09Rik A G 4: 124,610,694 W22R probably damaging Het
AA986860 A G 1: 130,743,094 E351G probably damaging Het
Acsl5 T C 19: 55,280,492 V195A probably benign Het
Adamts10 A G 17: 33,537,319 D312G probably benign Het
Adgrb1 A G 15: 74,580,617 M211V probably damaging Het
Ankfy1 C T 11: 72,755,867 R859* probably null Het
Atp8b1 T A 18: 64,550,432 I742L probably benign Het
B3galnt2 T A 13: 13,970,769 V89E probably damaging Het
BC024978 A G 7: 27,202,680 H244R probably damaging Het
Brinp3 A C 1: 146,901,890 T692P probably damaging Het
C9 T A 15: 6,486,762 F349I probably damaging Het
Cacna1a T A 8: 84,633,433 M1976K probably benign Het
Ccdc180 T C 4: 45,927,975 V1170A possibly damaging Het
Celsr1 A G 15: 85,931,276 V1846A probably benign Het
Ces1f A T 8: 93,271,889 Y160N possibly damaging Het
Cfap45 A G 1: 172,540,572 E377G probably damaging Het
Clca3a1 T A 3: 144,755,171 M240L probably benign Het
Clnk G A 5: 38,794,966 T10M probably damaging Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Col11a2 G A 17: 34,055,254 G375S probably damaging Het
Col6a5 T A 9: 105,939,994 I373F unknown Het
Dmxl1 C T 18: 49,852,367 A227V probably benign Het
Dok5 A G 2: 170,732,132 N4D probably benign Het
Dpysl3 A T 18: 43,363,557 V138D probably damaging Het
Efs A T 14: 54,919,715 Y380N probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Farp2 A G 1: 93,618,553 Q855R possibly damaging Het
Fcrls A C 3: 87,256,707 S372A possibly damaging Het
Gadl1 C T 9: 115,944,229 A113V probably damaging Het
Gatsl2 T G 5: 134,125,887 S43R probably damaging Het
Gda T A 19: 21,412,539 E219D probably benign Het
Gli1 A T 10: 127,332,577 M469K probably damaging Het
Gm4847 A T 1: 166,641,650 S148R probably damaging Het
Golga2 T C 2: 32,302,204 V325A probably benign Het
Hpf1 A G 8: 60,896,749 D137G probably damaging Het
Htr2a C G 14: 74,705,853 S291* probably null Het
Itga5 G A 15: 103,356,782 Q233* probably null Het
Jazf1 C A 6: 52,812,183 R102L probably damaging Het
Kif6 T G 17: 49,714,113 L322R probably damaging Het
Lig4 A T 8: 9,973,012 V256E possibly damaging Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp1 A T 10: 127,575,286 D1399E probably benign Het
Mmel1 A G 4: 154,894,986 E717G probably damaging Het
Mndal G T 1: 173,871,466 P155H possibly damaging Het
Mycbpap A G 11: 94,511,623 probably null Het
Nedd1 T C 10: 92,719,614 E3G probably damaging Het
Nlgn1 A T 3: 25,435,909 N551K probably damaging Het
Nup210 G A 6: 91,069,166 P595L possibly damaging Het
Olfr117 A T 17: 37,659,770 C188S probably damaging Het
Olfr1302 A T 2: 111,780,348 probably null Het
Olfr199 T G 16: 59,215,984 T210P probably damaging Het
Olfr477 A G 7: 107,990,533 H56R probably benign Het
Olfr697 A G 7: 106,741,005 C310R probably benign Het
Pank3 G A 11: 35,781,681 V304M probably benign Het
Phf3 G A 1: 30,805,648 T1410I probably benign Het
Ppm1k A G 6: 57,525,157 I7T possibly damaging Het
Ppp1r12c T C 7: 4,497,425 D73G probably damaging Het
Prelid2 T G 18: 41,881,267 M165L probably benign Het
Prkd3 A C 17: 78,952,696 L826R probably damaging Het
Ptchd4 A T 17: 42,503,542 N778I probably damaging Het
Ptprm T C 17: 66,693,871 D1063G possibly damaging Het
Rab27a C A 9: 73,075,482 T23N probably damaging Het
Rasgrf2 A T 13: 91,896,086 F949L probably benign Het
Rbm33 A G 5: 28,337,004 N68D probably damaging Het
Rgl1 A T 1: 152,586,533 L109Q probably damaging Het
Rnf20 A G 4: 49,638,197 N103S possibly damaging Het
Sbno1 G A 5: 124,392,612 L875F probably damaging Het
Scube1 T A 15: 83,628,076 probably null Het
Selenbp1 G A 3: 94,937,358 V109M probably damaging Het
Serpina3c T A 12: 104,151,546 I178F probably damaging Het
Shisa8 C T 15: 82,208,501 G63D probably damaging Het
Snx14 T C 9: 88,402,224 R464G possibly damaging Het
Snx25 A T 8: 46,124,082 M1K probably null Het
Sorcs3 C A 19: 48,706,009 T574K possibly damaging Het
Syne2 A G 12: 76,103,783 E6528G probably damaging Het
Syt5 T C 7: 4,540,246 E338G probably damaging Het
Tbk1 T C 10: 121,551,318 K691E probably benign Het
Tenm3 G A 8: 48,395,576 T11I probably damaging Het
Thrb A G 14: 18,002,597 H87R probably damaging Het
Tlr4 T A 4: 66,839,696 M242K possibly damaging Het
Tm4sf19 T C 16: 32,406,002 M56T possibly damaging Het
Tmem212 T A 3: 27,886,471 R66* probably null Het
Tmem39b G T 4: 129,684,482 D315E probably benign Het
Tnxb T C 17: 34,718,638 F3834L probably damaging Het
Trim36 A T 18: 46,186,183 L225* probably null Het
Trim42 A T 9: 97,365,679 H321Q probably damaging Het
Trio G T 15: 27,732,640 Q3052K probably benign Het
Trpm3 T C 19: 22,978,334 I1091T probably benign Het
Tst T C 15: 78,399,943 E228G possibly damaging Het
Ttn T C 2: 76,871,716 probably benign Het
Uap1 A C 1: 170,150,941 probably null Het
Ush2a T C 1: 188,797,814 S3267P possibly damaging Het
Usp5 T C 6: 124,825,166 T38A probably benign Het
Uvssa A T 5: 33,387,808 Q84L probably damaging Het
Vmn1r159 T G 7: 22,843,268 H113P probably damaging Het
Vps13d A T 4: 145,098,172 probably null Het
Zfp182 T A X: 21,031,560 I166L probably benign Het
Zfp811 A T 17: 32,797,648 Y472N probably damaging Het
Other mutations in Ktn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ktn1 APN 14 47708878 missense probably benign 0.30
IGL01109:Ktn1 APN 14 47714721 missense probably damaging 1.00
IGL02300:Ktn1 APN 14 47690060 missense probably damaging 1.00
IGL02339:Ktn1 APN 14 47683378 splice site probably benign
IGL02525:Ktn1 APN 14 47724743 critical splice donor site probably null
IGL02565:Ktn1 APN 14 47672934 splice site probably benign
IGL02678:Ktn1 APN 14 47734153 critical splice acceptor site probably null
IGL03181:Ktn1 APN 14 47733284 missense probably benign 0.19
IGL03393:Ktn1 APN 14 47690934 missense probably damaging 1.00
PIT4520001:Ktn1 UTSW 14 47686317 missense probably damaging 0.96
R0035:Ktn1 UTSW 14 47730379 missense probably benign 0.07
R0035:Ktn1 UTSW 14 47730379 missense probably benign 0.07
R0270:Ktn1 UTSW 14 47714662 missense probably benign 0.00
R0370:Ktn1 UTSW 14 47664075 missense probably benign 0.00
R0371:Ktn1 UTSW 14 47724003 nonsense probably null
R0530:Ktn1 UTSW 14 47733243 missense probably benign 0.14
R0531:Ktn1 UTSW 14 47663941 missense probably damaging 0.98
R0611:Ktn1 UTSW 14 47694616 missense probably benign
R0836:Ktn1 UTSW 14 47701062 splice site probably null
R1076:Ktn1 UTSW 14 47694638 missense probably damaging 0.99
R1554:Ktn1 UTSW 14 47695507 missense probably damaging 1.00
R1992:Ktn1 UTSW 14 47695521 missense probably damaging 1.00
R2040:Ktn1 UTSW 14 47700612 splice site probably benign
R2080:Ktn1 UTSW 14 47725960 missense probably damaging 1.00
R2110:Ktn1 UTSW 14 47693888 missense possibly damaging 0.47
R2144:Ktn1 UTSW 14 47714652 missense probably damaging 1.00
R3730:Ktn1 UTSW 14 47701149 missense probably damaging 1.00
R3780:Ktn1 UTSW 14 47706403 splice site probably benign
R3782:Ktn1 UTSW 14 47706403 splice site probably benign
R4414:Ktn1 UTSW 14 47724930 nonsense probably null
R4610:Ktn1 UTSW 14 47726179 intron probably benign
R4784:Ktn1 UTSW 14 47693496 critical splice donor site probably null
R4838:Ktn1 UTSW 14 47725956 nonsense probably null
R4909:Ktn1 UTSW 14 47706460 missense probably damaging 0.99
R4976:Ktn1 UTSW 14 47670299 critical splice donor site probably null
R5110:Ktn1 UTSW 14 47704287 splice site probably benign
R5257:Ktn1 UTSW 14 47667363 missense probably benign 0.05
R5469:Ktn1 UTSW 14 47690920 missense probably damaging 1.00
R5600:Ktn1 UTSW 14 47690033 missense probably damaging 1.00
R5607:Ktn1 UTSW 14 47734097 intron probably benign
R5608:Ktn1 UTSW 14 47734097 intron probably benign
R5920:Ktn1 UTSW 14 47724024 nonsense probably null
R6045:Ktn1 UTSW 14 47676796 missense probably damaging 1.00
R6139:Ktn1 UTSW 14 47726215 splice site probably null
R6282:Ktn1 UTSW 14 47663971 missense probably damaging 1.00
R6654:Ktn1 UTSW 14 47690000 missense probably damaging 1.00
R6957:Ktn1 UTSW 14 47667353 nonsense probably null
R6959:Ktn1 UTSW 14 47720256 missense probably damaging 1.00
R7170:Ktn1 UTSW 14 47706410 missense probably damaging 1.00
R7206:Ktn1 UTSW 14 47695528 missense probably damaging 0.97
R7442:Ktn1 UTSW 14 47714640 missense probably benign 0.01
R7462:Ktn1 UTSW 14 47694632 missense probably null 1.00
R7513:Ktn1 UTSW 14 47664084 missense possibly damaging 0.77
R7743:Ktn1 UTSW 14 47670293 missense probably damaging 1.00
R8010:Ktn1 UTSW 14 47705773 missense possibly damaging 0.60
R8062:Ktn1 UTSW 14 47724972 critical splice donor site probably null
R8244:Ktn1 UTSW 14 47674823 missense probably null 1.00
R8387:Ktn1 UTSW 14 47707287 splice site probably null
Z1177:Ktn1 UTSW 14 47692438 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGACCATACTGTGGGCTGGGAATG -3'
(R):5'- GCAATGCAACTACAAGATTGCAGAGC -3'

Sequencing Primer
(F):5'- GGGCCACATACATTAAAGACG -3'
(R):5'- CAAGATTGCAGAGCACTTTAGAC -3'
Posted On2014-04-13