Incidental Mutation 'R1522:Scube1'
Institutional Source Beutler Lab
Gene Symbol Scube1
Ensembl Gene ENSMUSG00000016763
Gene Namesignal peptide, CUB domain, EGF-like 1
Synonyms7330410C13Rik, A630023E24Rik
MMRRC Submission 040871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R1522 (G1)
Quality Score225
Status Not validated
Chromosomal Location83604999-83725021 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 83628076 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016907] [ENSMUST00000043634] [ENSMUST00000076060] [ENSMUST00000171496]
Predicted Effect probably null
Transcript: ENSMUST00000016907
SMART Domains Protein: ENSMUSP00000016907
Gene: ENSMUSG00000016763

signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 274 311 1.69e-3 SMART
EGF_CA 312 352 2.13e-9 SMART
EGF_CA 353 391 4.7e-11 SMART
EGF_CA 392 432 3.91e-8 SMART
low complexity region 560 573 N/A INTRINSIC
Pfam:GCC2_GCC3 666 713 4.5e-13 PFAM
EGF_like 766 804 6.81e1 SMART
CUB 828 940 1.51e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000043634
SMART Domains Protein: ENSMUSP00000044835
Gene: ENSMUSG00000016763

signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 163 200 1.69e-3 SMART
EGF_CA 201 241 2.13e-9 SMART
EGF_CA 242 280 4.7e-11 SMART
EGF_CA 281 321 3.91e-8 SMART
low complexity region 449 462 N/A INTRINSIC
Pfam:GCC2_GCC3 555 602 3.2e-11 PFAM
EGF_like 655 693 6.81e1 SMART
CUB 717 829 1.51e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076060
SMART Domains Protein: ENSMUSP00000075434
Gene: ENSMUSG00000016763

signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 244 281 1.69e-3 SMART
EGF_CA 282 322 2.13e-9 SMART
EGF_CA 323 361 4.7e-11 SMART
EGF_CA 362 402 3.91e-8 SMART
low complexity region 530 543 N/A INTRINSIC
Pfam:GCC2_GCC3 636 683 1.3e-11 PFAM
EGF_like 736 774 6.81e1 SMART
CUB 798 910 1.51e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144773
Predicted Effect probably null
Transcript: ENSMUST00000171496
SMART Domains Protein: ENSMUSP00000130131
Gene: ENSMUSG00000016763

signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 244 281 1.69e-3 SMART
EGF_CA 282 322 2.13e-9 SMART
EGF_CA 323 361 4.7e-11 SMART
EGF_CA 362 402 3.91e-8 SMART
low complexity region 530 543 N/A INTRINSIC
Pfam:GCC2_GCC3 636 683 1.7e-11 PFAM
EGF_like 736 774 6.81e1 SMART
CUB 798 910 1.51e-19 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface glycoprotein that is a member of the SCUBE (signal peptide, CUB domain, EGF (epidermal growth factor)-like protein) family. Family members have an amino-terminal signal peptide, nine copies of EGF-like repeats and a CUB domain at the carboxyl terminus. This protein is expressed in platelets and endothelial cells and may play an important role in vascular biology. [provided by RefSeq, Oct 2011]
PHENOTYPE: A fraction of homozygotes die neonatally with acrania and loss of brain tissue. Early skull bone defects include lack of the interparietal and supraoccipital bones and cranial vault. Affected mutant embryos show exencephaly, a thick-walled forebrain neuroepithelium and hyperplastic cranial ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik T C 6: 83,162,586 S498P probably damaging Het
3100002H09Rik A G 4: 124,610,694 W22R probably damaging Het
AA986860 A G 1: 130,743,094 E351G probably damaging Het
Acsl5 T C 19: 55,280,492 V195A probably benign Het
Adamts10 A G 17: 33,537,319 D312G probably benign Het
Adgrb1 A G 15: 74,580,617 M211V probably damaging Het
Ankfy1 C T 11: 72,755,867 R859* probably null Het
Atp8b1 T A 18: 64,550,432 I742L probably benign Het
B3galnt2 T A 13: 13,970,769 V89E probably damaging Het
BC024978 A G 7: 27,202,680 H244R probably damaging Het
Brinp3 A C 1: 146,901,890 T692P probably damaging Het
C9 T A 15: 6,486,762 F349I probably damaging Het
Cacna1a T A 8: 84,633,433 M1976K probably benign Het
Ccdc180 T C 4: 45,927,975 V1170A possibly damaging Het
Celsr1 A G 15: 85,931,276 V1846A probably benign Het
Ces1f A T 8: 93,271,889 Y160N possibly damaging Het
Cfap45 A G 1: 172,540,572 E377G probably damaging Het
Clca3a1 T A 3: 144,755,171 M240L probably benign Het
Clnk G A 5: 38,794,966 T10M probably damaging Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Col11a2 G A 17: 34,055,254 G375S probably damaging Het
Col6a5 T A 9: 105,939,994 I373F unknown Het
Dmxl1 C T 18: 49,852,367 A227V probably benign Het
Dok5 A G 2: 170,732,132 N4D probably benign Het
Dpysl3 A T 18: 43,363,557 V138D probably damaging Het
Efs A T 14: 54,919,715 Y380N probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Farp2 A G 1: 93,618,553 Q855R possibly damaging Het
Fcrls A C 3: 87,256,707 S372A possibly damaging Het
Gadl1 C T 9: 115,944,229 A113V probably damaging Het
Gatsl2 T G 5: 134,125,887 S43R probably damaging Het
Gda T A 19: 21,412,539 E219D probably benign Het
Gli1 A T 10: 127,332,577 M469K probably damaging Het
Gm4847 A T 1: 166,641,650 S148R probably damaging Het
Golga2 T C 2: 32,302,204 V325A probably benign Het
Hpf1 A G 8: 60,896,749 D137G probably damaging Het
Htr2a C G 14: 74,705,853 S291* probably null Het
Itga5 G A 15: 103,356,782 Q233* probably null Het
Jazf1 C A 6: 52,812,183 R102L probably damaging Het
Kif6 T G 17: 49,714,113 L322R probably damaging Het
Ktn1 A C 14: 47,667,416 K217T probably damaging Het
Lig4 A T 8: 9,973,012 V256E possibly damaging Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp1 A T 10: 127,575,286 D1399E probably benign Het
Mmel1 A G 4: 154,894,986 E717G probably damaging Het
Mndal G T 1: 173,871,466 P155H possibly damaging Het
Mycbpap A G 11: 94,511,623 probably null Het
Nedd1 T C 10: 92,719,614 E3G probably damaging Het
Nlgn1 A T 3: 25,435,909 N551K probably damaging Het
Nup210 G A 6: 91,069,166 P595L possibly damaging Het
Olfr117 A T 17: 37,659,770 C188S probably damaging Het
Olfr1302 A T 2: 111,780,348 probably null Het
Olfr199 T G 16: 59,215,984 T210P probably damaging Het
Olfr477 A G 7: 107,990,533 H56R probably benign Het
Olfr697 A G 7: 106,741,005 C310R probably benign Het
Pank3 G A 11: 35,781,681 V304M probably benign Het
Phf3 G A 1: 30,805,648 T1410I probably benign Het
Ppm1k A G 6: 57,525,157 I7T possibly damaging Het
Ppp1r12c T C 7: 4,497,425 D73G probably damaging Het
Prelid2 T G 18: 41,881,267 M165L probably benign Het
Prkd3 A C 17: 78,952,696 L826R probably damaging Het
Ptchd4 A T 17: 42,503,542 N778I probably damaging Het
Ptprm T C 17: 66,693,871 D1063G possibly damaging Het
Rab27a C A 9: 73,075,482 T23N probably damaging Het
Rasgrf2 A T 13: 91,896,086 F949L probably benign Het
Rbm33 A G 5: 28,337,004 N68D probably damaging Het
Rgl1 A T 1: 152,586,533 L109Q probably damaging Het
Rnf20 A G 4: 49,638,197 N103S possibly damaging Het
Sbno1 G A 5: 124,392,612 L875F probably damaging Het
Selenbp1 G A 3: 94,937,358 V109M probably damaging Het
Serpina3c T A 12: 104,151,546 I178F probably damaging Het
Shisa8 C T 15: 82,208,501 G63D probably damaging Het
Snx14 T C 9: 88,402,224 R464G possibly damaging Het
Snx25 A T 8: 46,124,082 M1K probably null Het
Sorcs3 C A 19: 48,706,009 T574K possibly damaging Het
Syne2 A G 12: 76,103,783 E6528G probably damaging Het
Syt5 T C 7: 4,540,246 E338G probably damaging Het
Tbk1 T C 10: 121,551,318 K691E probably benign Het
Tenm3 G A 8: 48,395,576 T11I probably damaging Het
Thrb A G 14: 18,002,597 H87R probably damaging Het
Tlr4 T A 4: 66,839,696 M242K possibly damaging Het
Tm4sf19 T C 16: 32,406,002 M56T possibly damaging Het
Tmem212 T A 3: 27,886,471 R66* probably null Het
Tmem39b G T 4: 129,684,482 D315E probably benign Het
Tnxb T C 17: 34,718,638 F3834L probably damaging Het
Trim36 A T 18: 46,186,183 L225* probably null Het
Trim42 A T 9: 97,365,679 H321Q probably damaging Het
Trio G T 15: 27,732,640 Q3052K probably benign Het
Trpm3 T C 19: 22,978,334 I1091T probably benign Het
Tst T C 15: 78,399,943 E228G possibly damaging Het
Ttn T C 2: 76,871,716 probably benign Het
Uap1 A C 1: 170,150,941 probably null Het
Ush2a T C 1: 188,797,814 S3267P possibly damaging Het
Usp5 T C 6: 124,825,166 T38A probably benign Het
Uvssa A T 5: 33,387,808 Q84L probably damaging Het
Vmn1r159 T G 7: 22,843,268 H113P probably damaging Het
Vps13d A T 4: 145,098,172 probably null Het
Zfp182 T A X: 21,031,560 I166L probably benign Het
Zfp811 A T 17: 32,797,648 Y472N probably damaging Het
Other mutations in Scube1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Scube1 APN 15 83703501 missense probably damaging 0.98
IGL01152:Scube1 APN 15 83613570 missense probably damaging 1.00
IGL01388:Scube1 APN 15 83620131 missense probably benign 0.00
IGL01589:Scube1 APN 15 83612553 missense probably damaging 1.00
IGL02208:Scube1 APN 15 83703540 missense probably damaging 1.00
IGL02305:Scube1 APN 15 83607390 missense probably damaging 1.00
IGL02728:Scube1 APN 15 83659016 splice site probably benign
IGL02737:Scube1 APN 15 83721843 splice site probably benign
IGL03326:Scube1 APN 15 83607416 missense probably damaging 1.00
R0055:Scube1 UTSW 15 83634736 missense probably damaging 1.00
R0055:Scube1 UTSW 15 83634736 missense probably damaging 1.00
R0126:Scube1 UTSW 15 83621063 missense probably damaging 1.00
R0792:Scube1 UTSW 15 83628076 critical splice acceptor site probably null
R1438:Scube1 UTSW 15 83615026 missense possibly damaging 0.93
R1735:Scube1 UTSW 15 83607437 missense probably damaging 1.00
R1766:Scube1 UTSW 15 83721945 missense probably damaging 1.00
R1778:Scube1 UTSW 15 83610204 missense probably damaging 1.00
R2975:Scube1 UTSW 15 83659098 missense probably damaging 0.99
R4080:Scube1 UTSW 15 83608747 missense probably damaging 1.00
R4434:Scube1 UTSW 15 83721924 missense probably damaging 1.00
R5585:Scube1 UTSW 15 83676923 missense probably damaging 1.00
R5857:Scube1 UTSW 15 83607260 unclassified probably benign
R5977:Scube1 UTSW 15 83629488 missense probably damaging 1.00
R6054:Scube1 UTSW 15 83651676 missense probably benign 0.43
R6461:Scube1 UTSW 15 83612427 missense probably damaging 1.00
R6956:Scube1 UTSW 15 83721876 missense probably damaging 1.00
R6959:Scube1 UTSW 15 83629435 missense probably benign 0.42
R7124:Scube1 UTSW 15 83629511 splice site probably null
R7267:Scube1 UTSW 15 83621065 missense probably damaging 1.00
R7404:Scube1 UTSW 15 83615010 missense probably damaging 0.98
R7584:Scube1 UTSW 15 83721887 nonsense probably null
R7585:Scube1 UTSW 15 83638787 missense possibly damaging 0.83
R7599:Scube1 UTSW 15 83613452 missense probably damaging 1.00
R8055:Scube1 UTSW 15 83659025 critical splice donor site probably null
R8098:Scube1 UTSW 15 83659088 missense probably damaging 1.00
R8192:Scube1 UTSW 15 83629382 critical splice donor site probably null
R8394:Scube1 UTSW 15 83608291 missense probably damaging 1.00
R8441:Scube1 UTSW 15 83610222 missense probably damaging 0.99
X0022:Scube1 UTSW 15 83634669 critical splice donor site probably null
Z1177:Scube1 UTSW 15 83612416 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gccagggctatacagagaaac -3'
Posted On2014-04-13