Incidental Mutation 'R1522:Zfp811'
ID167572
Institutional Source Beutler Lab
Gene Symbol Zfp811
Ensembl Gene ENSMUSG00000055202
Gene Namezinc finger protein 811
Synonyms
MMRRC Submission 040871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R1522 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32795676-32809853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32797648 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 472 (Y472N)
Ref Sequence ENSEMBL: ENSMUSP00000079709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080905] [ENSMUST00000200914]
Predicted Effect probably damaging
Transcript: ENSMUST00000080905
AA Change: Y472N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079709
Gene: ENSMUSG00000055202
AA Change: Y472N

DomainStartEndE-ValueType
KRAB 3 62 6.26e-16 SMART
ZnF_C2H2 192 215 1.25e-1 SMART
ZnF_C2H2 220 242 1.79e-2 SMART
ZnF_C2H2 248 270 9.08e-4 SMART
ZnF_C2H2 276 298 7.78e-3 SMART
ZnF_C2H2 304 326 3.69e-4 SMART
ZnF_C2H2 332 354 8.47e-4 SMART
ZnF_C2H2 360 382 1.45e-2 SMART
ZnF_C2H2 388 410 6.42e-4 SMART
ZnF_C2H2 416 438 5.9e-3 SMART
ZnF_C2H2 444 466 1.08e-1 SMART
ZnF_C2H2 472 494 2.75e-3 SMART
ZnF_C2H2 500 522 9.44e-2 SMART
ZnF_C2H2 528 551 3.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104150
Predicted Effect probably damaging
Transcript: ENSMUST00000200914
AA Change: Y473N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144038
Gene: ENSMUSG00000055202
AA Change: Y473N

DomainStartEndE-ValueType
KRAB 4 63 2.6e-18 SMART
ZnF_C2H2 193 216 5.4e-4 SMART
ZnF_C2H2 221 243 7.8e-5 SMART
ZnF_C2H2 249 271 3.8e-6 SMART
ZnF_C2H2 277 299 3.3e-5 SMART
ZnF_C2H2 305 327 1.6e-6 SMART
ZnF_C2H2 333 355 3.8e-6 SMART
ZnF_C2H2 361 383 6.1e-5 SMART
ZnF_C2H2 389 411 2.7e-6 SMART
ZnF_C2H2 417 439 2.5e-5 SMART
ZnF_C2H2 445 467 4.6e-4 SMART
ZnF_C2H2 473 495 1.2e-5 SMART
ZnF_C2H2 501 523 4e-4 SMART
ZnF_C2H2 529 552 1.7e-5 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik T C 6: 83,162,586 S498P probably damaging Het
3100002H09Rik A G 4: 124,610,694 W22R probably damaging Het
AA986860 A G 1: 130,743,094 E351G probably damaging Het
Acsl5 T C 19: 55,280,492 V195A probably benign Het
Adamts10 A G 17: 33,537,319 D312G probably benign Het
Adgrb1 A G 15: 74,580,617 M211V probably damaging Het
Ankfy1 C T 11: 72,755,867 R859* probably null Het
Atp8b1 T A 18: 64,550,432 I742L probably benign Het
B3galnt2 T A 13: 13,970,769 V89E probably damaging Het
BC024978 A G 7: 27,202,680 H244R probably damaging Het
Brinp3 A C 1: 146,901,890 T692P probably damaging Het
C9 T A 15: 6,486,762 F349I probably damaging Het
Cacna1a T A 8: 84,633,433 M1976K probably benign Het
Ccdc180 T C 4: 45,927,975 V1170A possibly damaging Het
Celsr1 A G 15: 85,931,276 V1846A probably benign Het
Ces1f A T 8: 93,271,889 Y160N possibly damaging Het
Cfap45 A G 1: 172,540,572 E377G probably damaging Het
Clca3a1 T A 3: 144,755,171 M240L probably benign Het
Clnk G A 5: 38,794,966 T10M probably damaging Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Col11a2 G A 17: 34,055,254 G375S probably damaging Het
Col6a5 T A 9: 105,939,994 I373F unknown Het
Dmxl1 C T 18: 49,852,367 A227V probably benign Het
Dok5 A G 2: 170,732,132 N4D probably benign Het
Dpysl3 A T 18: 43,363,557 V138D probably damaging Het
Efs A T 14: 54,919,715 Y380N probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Farp2 A G 1: 93,618,553 Q855R possibly damaging Het
Fcrls A C 3: 87,256,707 S372A possibly damaging Het
Gadl1 C T 9: 115,944,229 A113V probably damaging Het
Gatsl2 T G 5: 134,125,887 S43R probably damaging Het
Gda T A 19: 21,412,539 E219D probably benign Het
Gli1 A T 10: 127,332,577 M469K probably damaging Het
Gm4847 A T 1: 166,641,650 S148R probably damaging Het
Golga2 T C 2: 32,302,204 V325A probably benign Het
Hpf1 A G 8: 60,896,749 D137G probably damaging Het
Htr2a C G 14: 74,705,853 S291* probably null Het
Itga5 G A 15: 103,356,782 Q233* probably null Het
Jazf1 C A 6: 52,812,183 R102L probably damaging Het
Kif6 T G 17: 49,714,113 L322R probably damaging Het
Ktn1 A C 14: 47,667,416 K217T probably damaging Het
Lig4 A T 8: 9,973,012 V256E possibly damaging Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp1 A T 10: 127,575,286 D1399E probably benign Het
Mmel1 A G 4: 154,894,986 E717G probably damaging Het
Mndal G T 1: 173,871,466 P155H possibly damaging Het
Mycbpap A G 11: 94,511,623 probably null Het
Nedd1 T C 10: 92,719,614 E3G probably damaging Het
Nlgn1 A T 3: 25,435,909 N551K probably damaging Het
Nup210 G A 6: 91,069,166 P595L possibly damaging Het
Olfr117 A T 17: 37,659,770 C188S probably damaging Het
Olfr1302 A T 2: 111,780,348 probably null Het
Olfr199 T G 16: 59,215,984 T210P probably damaging Het
Olfr477 A G 7: 107,990,533 H56R probably benign Het
Olfr697 A G 7: 106,741,005 C310R probably benign Het
Pank3 G A 11: 35,781,681 V304M probably benign Het
Phf3 G A 1: 30,805,648 T1410I probably benign Het
Ppm1k A G 6: 57,525,157 I7T possibly damaging Het
Ppp1r12c T C 7: 4,497,425 D73G probably damaging Het
Prelid2 T G 18: 41,881,267 M165L probably benign Het
Prkd3 A C 17: 78,952,696 L826R probably damaging Het
Ptchd4 A T 17: 42,503,542 N778I probably damaging Het
Ptprm T C 17: 66,693,871 D1063G possibly damaging Het
Rab27a C A 9: 73,075,482 T23N probably damaging Het
Rasgrf2 A T 13: 91,896,086 F949L probably benign Het
Rbm33 A G 5: 28,337,004 N68D probably damaging Het
Rgl1 A T 1: 152,586,533 L109Q probably damaging Het
Rnf20 A G 4: 49,638,197 N103S possibly damaging Het
Sbno1 G A 5: 124,392,612 L875F probably damaging Het
Scube1 T A 15: 83,628,076 probably null Het
Selenbp1 G A 3: 94,937,358 V109M probably damaging Het
Serpina3c T A 12: 104,151,546 I178F probably damaging Het
Shisa8 C T 15: 82,208,501 G63D probably damaging Het
Snx14 T C 9: 88,402,224 R464G possibly damaging Het
Snx25 A T 8: 46,124,082 M1K probably null Het
Sorcs3 C A 19: 48,706,009 T574K possibly damaging Het
Syne2 A G 12: 76,103,783 E6528G probably damaging Het
Syt5 T C 7: 4,540,246 E338G probably damaging Het
Tbk1 T C 10: 121,551,318 K691E probably benign Het
Tenm3 G A 8: 48,395,576 T11I probably damaging Het
Thrb A G 14: 18,002,597 H87R probably damaging Het
Tlr4 T A 4: 66,839,696 M242K possibly damaging Het
Tm4sf19 T C 16: 32,406,002 M56T possibly damaging Het
Tmem212 T A 3: 27,886,471 R66* probably null Het
Tmem39b G T 4: 129,684,482 D315E probably benign Het
Tnxb T C 17: 34,718,638 F3834L probably damaging Het
Trim36 A T 18: 46,186,183 L225* probably null Het
Trim42 A T 9: 97,365,679 H321Q probably damaging Het
Trio G T 15: 27,732,640 Q3052K probably benign Het
Trpm3 T C 19: 22,978,334 I1091T probably benign Het
Tst T C 15: 78,399,943 E228G possibly damaging Het
Ttn T C 2: 76,871,716 probably benign Het
Uap1 A C 1: 170,150,941 probably null Het
Ush2a T C 1: 188,797,814 S3267P possibly damaging Het
Usp5 T C 6: 124,825,166 T38A probably benign Het
Uvssa A T 5: 33,387,808 Q84L probably damaging Het
Vmn1r159 T G 7: 22,843,268 H113P probably damaging Het
Vps13d A T 4: 145,098,172 probably null Het
Zfp182 T A X: 21,031,560 I166L probably benign Het
Other mutations in Zfp811
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Zfp811 APN 17 32797820 missense probably damaging 1.00
IGL02227:Zfp811 APN 17 32798642 nonsense probably null
IGL02529:Zfp811 APN 17 32797815 missense probably damaging 1.00
IGL03190:Zfp811 APN 17 32798881 splice site probably benign
R0112:Zfp811 UTSW 17 32797764 missense probably damaging 0.96
R1025:Zfp811 UTSW 17 32798644 missense probably benign 0.00
R1829:Zfp811 UTSW 17 32798142 missense possibly damaging 0.72
R1861:Zfp811 UTSW 17 32797425 missense probably damaging 1.00
R2181:Zfp811 UTSW 17 32797721 missense probably damaging 0.96
R4360:Zfp811 UTSW 17 32798458 missense probably benign 0.01
R4425:Zfp811 UTSW 17 32797547 nonsense probably null
R4657:Zfp811 UTSW 17 32800923 nonsense probably null
R6066:Zfp811 UTSW 17 32798827 missense possibly damaging 0.73
R6109:Zfp811 UTSW 17 32797374 splice site probably null
R6702:Zfp811 UTSW 17 32797842 missense probably damaging 1.00
R6714:Zfp811 UTSW 17 32797762 missense probably damaging 1.00
R6826:Zfp811 UTSW 17 32797788 missense probably damaging 1.00
R6983:Zfp811 UTSW 17 32797432 nonsense probably null
R7276:Zfp811 UTSW 17 32798781 missense probably benign 0.00
R7343:Zfp811 UTSW 17 32797513 missense probably damaging 0.98
R7432:Zfp811 UTSW 17 32798759 missense possibly damaging 0.73
R7523:Zfp811 UTSW 17 32797752 missense probably benign 0.10
R7894:Zfp811 UTSW 17 32798847 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GACTAAGAGACCGAAAGCCTTTCCC -3'
(R):5'- TCACAGCGGTGTGAATCCCTTTG -3'

Sequencing Primer
(F):5'- CGCATTTCTTACATTCATGGGG -3'
(R):5'- ACTGGTGAGAAGCCCTATGTG -3'
Posted On2014-04-13