Mutagenetix > Incidental Mutation

Incidental Mutation 'R1522:Ptprm'

167580

Institutional Source

Beutler Lab

Gene Symbol

Ptprm

Ensembl Gene

ENSMUSG00000033278

Gene Name

protein tyrosine phosphatase, receptor type, M

Synonyms

RPTPmu

MMRRC Submission

040871-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1522 (G1)

Quality Score

210

Status

Not validated

Chromosome

Chromosomal Location

66666947-67354457 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66693871 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1063 (D1063G)

Ref Sequence

ENSEMBL: ENSMUSP00000153662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037974] [ENSMUST00000223982]

AlphaFold

P28828

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037974
AA Change: D1097G

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000045603
Gene: ENSMUSG00000033278
AA Change: D1097G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
MAM	22	184	2.81e-73	SMART
IG	191	279	2.1e-6	SMART
FN3	281	364	6.35e-4	SMART
FN3	380	468	2.81e-5	SMART
FN3	482	572	3.7e-5	SMART
transmembrane domain	743	764	N/A	INTRINSIC
low complexity region	765	774	N/A	INTRINSIC
PTPc	899	1156	5.26e-135	SMART
PTPc	1185	1450	9.46e-96	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223982
AA Change: D1063G

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225074

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP has been shown to mediate cell-cell aggregation through the interaction with another molecule of this PTP on an adjacent cell. This PTP can interact with scaffolding protein RACK1/GNB2L1, which may be necessary for the downstream signaling in response to cell-cell adhesion. Alternative splicing results in multiple transcripts encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired flow-induced dilation in mesenteric resistance arteries. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	T	C	6: 83,162,586	S498P	probably damaging	Het
3100002H09Rik	A	G	4: 124,610,694	W22R	probably damaging	Het
AA986860	A	G	1: 130,743,094	E351G	probably damaging	Het
Acsl5	T	C	19: 55,280,492	V195A	probably benign	Het
Adamts10	A	G	17: 33,537,319	D312G	probably benign	Het
Adgrb1	A	G	15: 74,580,617	M211V	probably damaging	Het
Ankfy1	C	T	11: 72,755,867	R859*	probably null	Het
Atp8b1	T	A	18: 64,550,432	I742L	probably benign	Het
B3galnt2	T	A	13: 13,970,769	V89E	probably damaging	Het
BC024978	A	G	7: 27,202,680	H244R	probably damaging	Het
Brinp3	A	C	1: 146,901,890	T692P	probably damaging	Het
C9	T	A	15: 6,486,762	F349I	probably damaging	Het
Cacna1a	T	A	8: 84,633,433	M1976K	probably benign	Het
Ccdc180	T	C	4: 45,927,975	V1170A	possibly damaging	Het
Celsr1	A	G	15: 85,931,276	V1846A	probably benign	Het
Ces1f	A	T	8: 93,271,889	Y160N	possibly damaging	Het
Cfap45	A	G	1: 172,540,572	E377G	probably damaging	Het
Clca3a1	T	A	3: 144,755,171	M240L	probably benign	Het
Clnk	G	A	5: 38,794,966	T10M	probably damaging	Het
Cntrl	T	A	2: 35,155,279	I781K	possibly damaging	Het
Col11a2	G	A	17: 34,055,254	G375S	probably damaging	Het
Col6a5	T	A	9: 105,939,994	I373F	unknown	Het
Dmxl1	C	T	18: 49,852,367	A227V	probably benign	Het
Dok5	A	G	2: 170,732,132	N4D	probably benign	Het
Dpysl3	A	T	18: 43,363,557	V138D	probably damaging	Het
Efs	A	T	14: 54,919,715	Y380N	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Farp2	A	G	1: 93,618,553	Q855R	possibly damaging	Het
Fcrls	A	C	3: 87,256,707	S372A	possibly damaging	Het
Gadl1	C	T	9: 115,944,229	A113V	probably damaging	Het
Gatsl2	T	G	5: 134,125,887	S43R	probably damaging	Het
Gda	T	A	19: 21,412,539	E219D	probably benign	Het
Gli1	A	T	10: 127,332,577	M469K	probably damaging	Het
Gm4847	A	T	1: 166,641,650	S148R	probably damaging	Het
Golga2	T	C	2: 32,302,204	V325A	probably benign	Het
Hpf1	A	G	8: 60,896,749	D137G	probably damaging	Het
Htr2a	C	G	14: 74,705,853	S291*	probably null	Het
Itga5	G	A	15: 103,356,782	Q233*	probably null	Het
Jazf1	C	A	6: 52,812,183	R102L	probably damaging	Het
Kif6	T	G	17: 49,714,113	L322R	probably damaging	Het
Ktn1	A	C	14: 47,667,416	K217T	probably damaging	Het
Lig4	A	T	8: 9,973,012	V256E	possibly damaging	Het
Lrp1	G	T	10: 127,567,364	D2113E	probably damaging	Het
Lrp1	A	T	10: 127,575,286	D1399E	probably benign	Het
Mmel1	A	G	4: 154,894,986	E717G	probably damaging	Het
Mndal	G	T	1: 173,871,466	P155H	possibly damaging	Het
Mycbpap	A	G	11: 94,511,623		probably null	Het
Nedd1	T	C	10: 92,719,614	E3G	probably damaging	Het
Nlgn1	A	T	3: 25,435,909	N551K	probably damaging	Het
Nup210	G	A	6: 91,069,166	P595L	possibly damaging	Het
Olfr117	A	T	17: 37,659,770	C188S	probably damaging	Het
Olfr1302	A	T	2: 111,780,348		probably null	Het
Olfr199	T	G	16: 59,215,984	T210P	probably damaging	Het
Olfr477	A	G	7: 107,990,533	H56R	probably benign	Het
Olfr697	A	G	7: 106,741,005	C310R	probably benign	Het
Pank3	G	A	11: 35,781,681	V304M	probably benign	Het
Phf3	G	A	1: 30,805,648	T1410I	probably benign	Het
Ppm1k	A	G	6: 57,525,157	I7T	possibly damaging	Het
Ppp1r12c	T	C	7: 4,497,425	D73G	probably damaging	Het
Prelid2	T	G	18: 41,881,267	M165L	probably benign	Het
Prkd3	A	C	17: 78,952,696	L826R	probably damaging	Het
Ptchd4	A	T	17: 42,503,542	N778I	probably damaging	Het
Rab27a	C	A	9: 73,075,482	T23N	probably damaging	Het
Rasgrf2	A	T	13: 91,896,086	F949L	probably benign	Het
Rbm33	A	G	5: 28,337,004	N68D	probably damaging	Het
Rgl1	A	T	1: 152,586,533	L109Q	probably damaging	Het
Rnf20	A	G	4: 49,638,197	N103S	possibly damaging	Het
Sbno1	G	A	5: 124,392,612	L875F	probably damaging	Het
Scube1	T	A	15: 83,628,076		probably null	Het
Selenbp1	G	A	3: 94,937,358	V109M	probably damaging	Het
Serpina3c	T	A	12: 104,151,546	I178F	probably damaging	Het
Shisa8	C	T	15: 82,208,501	G63D	probably damaging	Het
Snx14	T	C	9: 88,402,224	R464G	possibly damaging	Het
Snx25	A	T	8: 46,124,082	M1K	probably null	Het
Sorcs3	C	A	19: 48,706,009	T574K	possibly damaging	Het
Syne2	A	G	12: 76,103,783	E6528G	probably damaging	Het
Syt5	T	C	7: 4,540,246	E338G	probably damaging	Het
Tbk1	T	C	10: 121,551,318	K691E	probably benign	Het
Tenm3	G	A	8: 48,395,576	T11I	probably damaging	Het
Thrb	A	G	14: 18,002,597	H87R	probably damaging	Het
Tlr4	T	A	4: 66,839,696	M242K	possibly damaging	Het
Tm4sf19	T	C	16: 32,406,002	M56T	possibly damaging	Het
Tmem212	T	A	3: 27,886,471	R66*	probably null	Het
Tmem39b	G	T	4: 129,684,482	D315E	probably benign	Het
Tnxb	T	C	17: 34,718,638	F3834L	probably damaging	Het
Trim36	A	T	18: 46,186,183	L225*	probably null	Het
Trim42	A	T	9: 97,365,679	H321Q	probably damaging	Het
Trio	G	T	15: 27,732,640	Q3052K	probably benign	Het
Trpm3	T	C	19: 22,978,334	I1091T	probably benign	Het
Tst	T	C	15: 78,399,943	E228G	possibly damaging	Het
Ttn	T	C	2: 76,871,716		probably benign	Het
Uap1	A	C	1: 170,150,941		probably null	Het
Ush2a	T	C	1: 188,797,814	S3267P	possibly damaging	Het
Usp5	T	C	6: 124,825,166	T38A	probably benign	Het
Uvssa	A	T	5: 33,387,808	Q84L	probably damaging	Het
Vmn1r159	T	G	7: 22,843,268	H113P	probably damaging	Het
Vps13d	A	T	4: 145,098,172		probably null	Het
Zfp182	T	A	X: 21,031,560	I166L	probably benign	Het
Zfp811	A	T	17: 32,797,648	Y472N	probably damaging	Het

Other mutations in Ptprm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Ptprm	APN	17	66817972	missense	probably damaging	1.00
IGL01128:Ptprm	APN	17	67042101	missense	probably damaging	1.00
IGL01509:Ptprm	APN	17	66762213	missense	possibly damaging	0.95
IGL01785:Ptprm	APN	17	66685623	missense	probably damaging	1.00
IGL01912:Ptprm	APN	17	67046118	missense	probably benign	0.13
IGL01929:Ptprm	APN	17	66690549	missense	probably damaging	1.00
IGL01937:Ptprm	APN	17	67046163	splice site	probably benign
IGL01939:Ptprm	APN	17	67063163	splice site	probably benign
IGL02053:Ptprm	APN	17	66693841	missense	probably damaging	1.00
IGL02203:Ptprm	APN	17	66953123	missense	probably damaging	1.00
IGL02468:Ptprm	APN	17	66814509	missense	probably benign	0.02
IGL02500:Ptprm	APN	17	66920048	missense	probably damaging	0.99
IGL02542:Ptprm	APN	17	66920150	missense	probably benign
Becalming	UTSW	17	66944332	splice site	probably null
Pacifying	UTSW	17	66683408	missense	possibly damaging	0.74
R0674:Ptprm	UTSW	17	67191341	missense	possibly damaging	0.52
R0709:Ptprm	UTSW	17	66944332	splice site	probably null
R1054:Ptprm	UTSW	17	67042318	missense	probably damaging	1.00
R1561:Ptprm	UTSW	17	66940541	missense	probably damaging	1.00
R1726:Ptprm	UTSW	17	67042327	missense	probably damaging	1.00
R1744:Ptprm	UTSW	17	66689366	missense	probably damaging	1.00
R1873:Ptprm	UTSW	17	66688355	missense	probably damaging	1.00
R1951:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1952:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1953:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1993:Ptprm	UTSW	17	66747160	missense	probably damaging	1.00
R2017:Ptprm	UTSW	17	66957153	splice site	probably null
R2266:Ptprm	UTSW	17	66725851	splice site	probably null
R2417:Ptprm	UTSW	17	66944326	missense	probably damaging	0.97
R2511:Ptprm	UTSW	17	66693778	missense	probably damaging	1.00
R3726:Ptprm	UTSW	17	66956860	missense	possibly damaging	0.91
R3824:Ptprm	UTSW	17	66809575	missense	probably benign	0.40
R4057:Ptprm	UTSW	17	67075663	missense	possibly damaging	0.93
R4113:Ptprm	UTSW	17	66725813	missense	probably damaging	1.00
R4559:Ptprm	UTSW	17	66683408	missense	possibly damaging	0.74
R4598:Ptprm	UTSW	17	67095497	missense	probably benign	0.00
R4742:Ptprm	UTSW	17	66744751	nonsense	probably null
R4974:Ptprm	UTSW	17	66678067	missense	probably benign	0.01
R5157:Ptprm	UTSW	17	66957097	missense	probably benign	0.09
R5433:Ptprm	UTSW	17	66693473	missense	probably damaging	1.00
R5509:Ptprm	UTSW	17	66689358	missense	probably damaging	1.00
R5586:Ptprm	UTSW	17	66920196	missense	probably damaging	1.00
R5820:Ptprm	UTSW	17	66689465	missense	probably damaging	1.00
R5867:Ptprm	UTSW	17	67045981	splice site	probably null
R6044:Ptprm	UTSW	17	66693862	missense	probably damaging	1.00
R6229:Ptprm	UTSW	17	66688300	missense	probably damaging	1.00
R6615:Ptprm	UTSW	17	67353956	critical splice donor site	probably null
R6969:Ptprm	UTSW	17	66912418	missense	possibly damaging	0.63
R7135:Ptprm	UTSW	17	66944288	missense	possibly damaging	0.93
R7161:Ptprm	UTSW	17	66809627	missense	probably benign	0.21
R7410:Ptprm	UTSW	17	66693566	missense	probably damaging	0.99
R7476:Ptprm	UTSW	17	66725791	missense	probably benign	0.01
R7789:Ptprm	UTSW	17	67095539	missense	probably damaging	1.00
R8027:Ptprm	UTSW	17	66944205	missense	probably damaging	1.00
R8089:Ptprm	UTSW	17	66683488	missense	possibly damaging	0.63
R8442:Ptprm	UTSW	17	66944317	missense	possibly damaging	0.70
R8476:Ptprm	UTSW	17	66944322	missense	probably damaging	1.00
R8866:Ptprm	UTSW	17	66809635	missense	probably benign	0.00
R8907:Ptprm	UTSW	17	66744737	missense	probably damaging	0.99
R8930:Ptprm	UTSW	17	66956851	missense	probably benign	0.03
R8932:Ptprm	UTSW	17	66956851	missense	probably benign	0.03
R9009:Ptprm	UTSW	17	66689359	missense	probably damaging	1.00
R9084:Ptprm	UTSW	17	66956953	missense	possibly damaging	0.93
R9338:Ptprm	UTSW	17	66762148	missense	probably damaging	1.00
R9514:Ptprm	UTSW	17	66809471	missense	probably damaging	1.00
R9610:Ptprm	UTSW	17	66693488	missense	probably damaging	1.00
R9611:Ptprm	UTSW	17	66693488	missense	probably damaging	1.00
R9620:Ptprm	UTSW	17	66809489	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACAATGAAGCAACCTGTCCTTCC -3'
(R):5'- ACAAAGGCCCGTCTTTCTCAGCTC -3'

Sequencing Primer
(F):5'- AGGCTTCTAGCGTCCTAAAC -3'
(R):5'- GCTCTACACTCGCTCTCAGAAG -3'

Posted On

2014-04-13