Mutagenetix > Incidental Mutations

Incidental Mutation 'R1522:Trpm3'

167589

Institutional Source

Beutler Lab

Gene Symbol

Trpm3

Ensembl Gene

ENSMUSG00000052387

Gene Name

transient receptor potential cation channel, subfamily M, member 3

Synonyms

B930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3

MMRRC Submission

040871-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R1522 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22139119-22989884 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22978334 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1091 (I1091T)

Ref Sequence

ENSEMBL: ENSMUSP00000084857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000099569]

AlphaFold

J9S314

Predicted Effect

probably benign
Transcript: ENSMUST00000037901
AA Change: I1089T

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387
AA Change: I1089T

Domain	Start	End	E-Value	Type
Blast:ANK	485	514	1e-6	BLAST
low complexity region	619	631	N/A	INTRINSIC
low complexity region	674	689	N/A	INTRINSIC
low complexity region	788	800	N/A	INTRINSIC
low complexity region	821	840	N/A	INTRINSIC
Pfam:Ion_trans	883	1136	1.7e-19	PFAM
Pfam:TRPM_tetra	1227	1282	1.5e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000074770
AA Change: I1081T

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387
AA Change: I1081T

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	611	623	N/A	INTRINSIC
low complexity region	666	681	N/A	INTRINSIC
low complexity region	780	792	N/A	INTRINSIC
low complexity region	813	832	N/A	INTRINSIC
transmembrane domain	874	896	N/A	INTRINSIC
Pfam:Ion_trans	908	1116	5.1e-14	PFAM
low complexity region	1378	1388	N/A	INTRINSIC
low complexity region	1433	1455	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000087576
AA Change: I1091T

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387
AA Change: I1091T

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	621	633	N/A	INTRINSIC
low complexity region	676	691	N/A	INTRINSIC
low complexity region	790	802	N/A	INTRINSIC
low complexity region	823	842	N/A	INTRINSIC
transmembrane domain	884	906	N/A	INTRINSIC
Pfam:Ion_trans	918	1126	5.1e-14	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099569
AA Change: I1091T

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387
AA Change: I1091T

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	6e-7	BLAST
low complexity region	609	621	N/A	INTRINSIC
low complexity region	664	679	N/A	INTRINSIC
low complexity region	778	790	N/A	INTRINSIC
low complexity region	811	830	N/A	INTRINSIC
Pfam:Ion_trans	873	1138	3.2e-19	PFAM
Pfam:TRPM_tetra	1229	1284	4.4e-26	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	T	C	6: 83,162,586	S498P	probably damaging	Het
3100002H09Rik	A	G	4: 124,610,694	W22R	probably damaging	Het
AA986860	A	G	1: 130,743,094	E351G	probably damaging	Het
Acsl5	T	C	19: 55,280,492	V195A	probably benign	Het
Adamts10	A	G	17: 33,537,319	D312G	probably benign	Het
Adgrb1	A	G	15: 74,580,617	M211V	probably damaging	Het
Ankfy1	C	T	11: 72,755,867	R859*	probably null	Het
Atp8b1	T	A	18: 64,550,432	I742L	probably benign	Het
B3galnt2	T	A	13: 13,970,769	V89E	probably damaging	Het
BC024978	A	G	7: 27,202,680	H244R	probably damaging	Het
Brinp3	A	C	1: 146,901,890	T692P	probably damaging	Het
C9	T	A	15: 6,486,762	F349I	probably damaging	Het
Cacna1a	T	A	8: 84,633,433	M1976K	probably benign	Het
Ccdc180	T	C	4: 45,927,975	V1170A	possibly damaging	Het
Celsr1	A	G	15: 85,931,276	V1846A	probably benign	Het
Ces1f	A	T	8: 93,271,889	Y160N	possibly damaging	Het
Cfap45	A	G	1: 172,540,572	E377G	probably damaging	Het
Clca3a1	T	A	3: 144,755,171	M240L	probably benign	Het
Clnk	G	A	5: 38,794,966	T10M	probably damaging	Het
Cntrl	T	A	2: 35,155,279	I781K	possibly damaging	Het
Col11a2	G	A	17: 34,055,254	G375S	probably damaging	Het
Col6a5	T	A	9: 105,939,994	I373F	unknown	Het
Dmxl1	C	T	18: 49,852,367	A227V	probably benign	Het
Dok5	A	G	2: 170,732,132	N4D	probably benign	Het
Dpysl3	A	T	18: 43,363,557	V138D	probably damaging	Het
Efs	A	T	14: 54,919,715	Y380N	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Farp2	A	G	1: 93,618,553	Q855R	possibly damaging	Het
Fcrls	A	C	3: 87,256,707	S372A	possibly damaging	Het
Gadl1	C	T	9: 115,944,229	A113V	probably damaging	Het
Gatsl2	T	G	5: 134,125,887	S43R	probably damaging	Het
Gda	T	A	19: 21,412,539	E219D	probably benign	Het
Gli1	A	T	10: 127,332,577	M469K	probably damaging	Het
Gm4847	A	T	1: 166,641,650	S148R	probably damaging	Het
Golga2	T	C	2: 32,302,204	V325A	probably benign	Het
Hpf1	A	G	8: 60,896,749	D137G	probably damaging	Het
Htr2a	C	G	14: 74,705,853	S291*	probably null	Het
Itga5	G	A	15: 103,356,782	Q233*	probably null	Het
Jazf1	C	A	6: 52,812,183	R102L	probably damaging	Het
Kif6	T	G	17: 49,714,113	L322R	probably damaging	Het
Ktn1	A	C	14: 47,667,416	K217T	probably damaging	Het
Lig4	A	T	8: 9,973,012	V256E	possibly damaging	Het
Lrp1	G	T	10: 127,567,364	D2113E	probably damaging	Het
Lrp1	A	T	10: 127,575,286	D1399E	probably benign	Het
Mmel1	A	G	4: 154,894,986	E717G	probably damaging	Het
Mndal	G	T	1: 173,871,466	P155H	possibly damaging	Het
Mycbpap	A	G	11: 94,511,623		probably null	Het
Nedd1	T	C	10: 92,719,614	E3G	probably damaging	Het
Nlgn1	A	T	3: 25,435,909	N551K	probably damaging	Het
Nup210	G	A	6: 91,069,166	P595L	possibly damaging	Het
Olfr117	A	T	17: 37,659,770	C188S	probably damaging	Het
Olfr1302	A	T	2: 111,780,348		probably null	Het
Olfr199	T	G	16: 59,215,984	T210P	probably damaging	Het
Olfr477	A	G	7: 107,990,533	H56R	probably benign	Het
Olfr697	A	G	7: 106,741,005	C310R	probably benign	Het
Pank3	G	A	11: 35,781,681	V304M	probably benign	Het
Phf3	G	A	1: 30,805,648	T1410I	probably benign	Het
Ppm1k	A	G	6: 57,525,157	I7T	possibly damaging	Het
Ppp1r12c	T	C	7: 4,497,425	D73G	probably damaging	Het
Prelid2	T	G	18: 41,881,267	M165L	probably benign	Het
Prkd3	A	C	17: 78,952,696	L826R	probably damaging	Het
Ptchd4	A	T	17: 42,503,542	N778I	probably damaging	Het
Ptprm	T	C	17: 66,693,871	D1063G	possibly damaging	Het
Rab27a	C	A	9: 73,075,482	T23N	probably damaging	Het
Rasgrf2	A	T	13: 91,896,086	F949L	probably benign	Het
Rbm33	A	G	5: 28,337,004	N68D	probably damaging	Het
Rgl1	A	T	1: 152,586,533	L109Q	probably damaging	Het
Rnf20	A	G	4: 49,638,197	N103S	possibly damaging	Het
Sbno1	G	A	5: 124,392,612	L875F	probably damaging	Het
Scube1	T	A	15: 83,628,076		probably null	Het
Selenbp1	G	A	3: 94,937,358	V109M	probably damaging	Het
Serpina3c	T	A	12: 104,151,546	I178F	probably damaging	Het
Shisa8	C	T	15: 82,208,501	G63D	probably damaging	Het
Snx14	T	C	9: 88,402,224	R464G	possibly damaging	Het
Snx25	A	T	8: 46,124,082	M1K	probably null	Het
Sorcs3	C	A	19: 48,706,009	T574K	possibly damaging	Het
Syne2	A	G	12: 76,103,783	E6528G	probably damaging	Het
Syt5	T	C	7: 4,540,246	E338G	probably damaging	Het
Tbk1	T	C	10: 121,551,318	K691E	probably benign	Het
Tenm3	G	A	8: 48,395,576	T11I	probably damaging	Het
Thrb	A	G	14: 18,002,597	H87R	probably damaging	Het
Tlr4	T	A	4: 66,839,696	M242K	possibly damaging	Het
Tm4sf19	T	C	16: 32,406,002	M56T	possibly damaging	Het
Tmem212	T	A	3: 27,886,471	R66*	probably null	Het
Tmem39b	G	T	4: 129,684,482	D315E	probably benign	Het
Tnxb	T	C	17: 34,718,638	F3834L	probably damaging	Het
Trim36	A	T	18: 46,186,183	L225*	probably null	Het
Trim42	A	T	9: 97,365,679	H321Q	probably damaging	Het
Trio	G	T	15: 27,732,640	Q3052K	probably benign	Het
Tst	T	C	15: 78,399,943	E228G	possibly damaging	Het
Ttn	T	C	2: 76,871,716		probably benign	Het
Uap1	A	C	1: 170,150,941		probably null	Het
Ush2a	T	C	1: 188,797,814	S3267P	possibly damaging	Het
Usp5	T	C	6: 124,825,166	T38A	probably benign	Het
Uvssa	A	T	5: 33,387,808	Q84L	probably damaging	Het
Vmn1r159	T	G	7: 22,843,268	H113P	probably damaging	Het
Vps13d	A	T	4: 145,098,172		probably null	Het
Zfp182	T	A	X: 21,031,560	I166L	probably benign	Het
Zfp811	A	T	17: 32,797,648	Y472N	probably damaging	Het

Other mutations in Trpm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Trpm3	APN	19	22987659	missense	probably benign	0.00
IGL00773:Trpm3	APN	19	22900159	missense	possibly damaging	0.92
IGL00852:Trpm3	APN	19	22987071	missense	possibly damaging	0.93
IGL01597:Trpm3	APN	19	22715246	missense	probably damaging	1.00
IGL01607:Trpm3	APN	19	22987127	missense	probably benign	0.01
IGL01818:Trpm3	APN	19	22914474	missense	probably damaging	1.00
IGL01890:Trpm3	APN	19	22711719	missense	probably damaging	0.98
IGL02016:Trpm3	APN	19	22902069	nonsense	probably null
IGL02324:Trpm3	APN	19	22698779	missense	probably benign	0.25
IGL02947:Trpm3	APN	19	22901119	missense	probably damaging	0.99
IGL03037:Trpm3	APN	19	22889412	missense	possibly damaging	0.85
IGL03128:Trpm3	APN	19	22914465	missense	probably damaging	1.00
IGL03335:Trpm3	APN	19	22926071	critical splice donor site	probably null
IGL03354:Trpm3	APN	19	22856718	missense	probably damaging	1.00
bit	UTSW	19	22987869	missense	probably benign	0.00
G1patch:Trpm3	UTSW	19	22926028	missense	probably damaging	1.00
P0041:Trpm3	UTSW	19	22897686	missense	probably benign	0.01
R0001:Trpm3	UTSW	19	22715331	missense	possibly damaging	0.70
R0007:Trpm3	UTSW	19	22987529	missense	probably benign	0.00
R0007:Trpm3	UTSW	19	22987529	missense	probably benign	0.00
R0009:Trpm3	UTSW	19	22914446	missense	probably damaging	1.00
R0009:Trpm3	UTSW	19	22914446	missense	probably damaging	1.00
R0142:Trpm3	UTSW	19	22987916	missense	probably damaging	0.98
R0194:Trpm3	UTSW	19	22715356	splice site	probably null
R0268:Trpm3	UTSW	19	22897521	critical splice donor site	probably null
R0299:Trpm3	UTSW	19	22986873	missense	possibly damaging	0.62
R0449:Trpm3	UTSW	19	22988054	missense	probably benign
R0481:Trpm3	UTSW	19	22901071	missense	possibly damaging	0.51
R0496:Trpm3	UTSW	19	22698778	missense	probably benign	0.00
R0499:Trpm3	UTSW	19	22986873	missense	possibly damaging	0.62
R0550:Trpm3	UTSW	19	22987812	missense	probably damaging	0.97
R0729:Trpm3	UTSW	19	22987789	missense	probably benign
R0883:Trpm3	UTSW	19	22978654	missense	probably damaging	1.00
R0926:Trpm3	UTSW	19	22988043	missense	probably benign	0.02
R1185:Trpm3	UTSW	19	22914417	splice site	probably benign
R1185:Trpm3	UTSW	19	22914417	splice site	probably benign
R1513:Trpm3	UTSW	19	22986872	missense	possibly damaging	0.96
R1521:Trpm3	UTSW	19	22901221	missense	probably damaging	1.00
R1569:Trpm3	UTSW	19	22889445	critical splice donor site	probably null
R1598:Trpm3	UTSW	19	22733024	missense	possibly damaging	0.47
R1600:Trpm3	UTSW	19	22139155	missense	probably benign	0.00
R1616:Trpm3	UTSW	19	22982712	missense	probably damaging	1.00
R1619:Trpm3	UTSW	19	22711907	missense	probably damaging	0.99
R1923:Trpm3	UTSW	19	22885412	missense	probably damaging	1.00
R1985:Trpm3	UTSW	19	22926082	missense	possibly damaging	0.56
R2002:Trpm3	UTSW	19	22982583	missense	probably damaging	1.00
R2249:Trpm3	UTSW	19	22733034	missense	probably benign	0.15
R3719:Trpm3	UTSW	19	22986990	missense	possibly damaging	0.95
R3766:Trpm3	UTSW	19	22448377	missense	probably benign
R3774:Trpm3	UTSW	19	22978602	missense	possibly damaging	0.66
R3774:Trpm3	UTSW	19	22987975	missense	probably benign	0.03
R3776:Trpm3	UTSW	19	22978602	missense	possibly damaging	0.66
R3820:Trpm3	UTSW	19	22987449	missense	probably benign	0.00
R3899:Trpm3	UTSW	19	22901160	missense	possibly damaging	0.90
R4204:Trpm3	UTSW	19	22987564	missense	probably benign	0.00
R4238:Trpm3	UTSW	19	22978638	missense	probably damaging	1.00
R4301:Trpm3	UTSW	19	22987292	missense	probably benign	0.23
R4344:Trpm3	UTSW	19	22897697	missense	probably damaging	0.99
R4345:Trpm3	UTSW	19	22897697	missense	probably damaging	0.99
R4365:Trpm3	UTSW	19	22978330	missense	probably benign	0.00
R4510:Trpm3	UTSW	19	22988017	missense	probably benign	0.00
R4511:Trpm3	UTSW	19	22988017	missense	probably benign	0.00
R4565:Trpm3	UTSW	19	22987869	missense	probably benign	0.00
R4573:Trpm3	UTSW	19	22902142	missense	probably damaging	1.00
R4606:Trpm3	UTSW	19	22978624	missense	probably benign	0.26
R4677:Trpm3	UTSW	19	22987388	missense	possibly damaging	0.95
R4684:Trpm3	UTSW	19	22987781	missense	probably benign
R4713:Trpm3	UTSW	19	22889435	missense	possibly damaging	0.83
R4745:Trpm3	UTSW	19	22715295	missense	possibly damaging	0.67
R5015:Trpm3	UTSW	19	22711712	missense	probably damaging	1.00
R5030:Trpm3	UTSW	19	22698766	missense	probably benign	0.01
R5074:Trpm3	UTSW	19	22885349	missense	possibly damaging	0.65
R5089:Trpm3	UTSW	19	22766756	missense	probably damaging	0.97
R5100:Trpm3	UTSW	19	22918766	missense	probably damaging	0.99
R5108:Trpm3	UTSW	19	22904714	missense	probably benign	0.06
R5204:Trpm3	UTSW	19	22448341	nonsense	probably null
R5213:Trpm3	UTSW	19	22697454	nonsense	probably null
R5358:Trpm3	UTSW	19	22925968	missense	probably damaging	1.00
R5374:Trpm3	UTSW	19	22926184	nonsense	probably null
R5382:Trpm3	UTSW	19	22885341	splice site	probably null
R5509:Trpm3	UTSW	19	22987258	missense	probably damaging	0.99
R5558:Trpm3	UTSW	19	22978573	missense	probably damaging	1.00
R6154:Trpm3	UTSW	19	22987814	missense	probably damaging	1.00
R6250:Trpm3	UTSW	19	22910054	missense	probably benign	0.01
R6433:Trpm3	UTSW	19	22901305	missense	probably damaging	1.00
R6542:Trpm3	UTSW	19	22926113	missense	probably benign	0.04
R6630:Trpm3	UTSW	19	22987983	missense	probably benign	0.00
R6640:Trpm3	UTSW	19	22978582	missense	probably damaging	1.00
R6725:Trpm3	UTSW	19	22926028	missense	probably damaging	1.00
R7275:Trpm3	UTSW	19	22978684	missense	possibly damaging	0.71
R7371:Trpm3	UTSW	19	22902193	missense	probably benign	0.27
R7467:Trpm3	UTSW	19	22978334	missense	possibly damaging	0.82
R7488:Trpm3	UTSW	19	22978573	missense	probably damaging	1.00
R7495:Trpm3	UTSW	19	22897796	missense	probably benign	0.28
R7600:Trpm3	UTSW	19	22926094	missense	possibly damaging	0.68
R7710:Trpm3	UTSW	19	22918790	missense	probably damaging	0.97
R7877:Trpm3	UTSW	19	22904784	missense	probably benign	0.25
R8184:Trpm3	UTSW	19	22918696	missense	possibly damaging	0.46
R8234:Trpm3	UTSW	19	22715276	missense	possibly damaging	0.47
R8236:Trpm3	UTSW	19	22987408	missense	probably benign	0.00
R8443:Trpm3	UTSW	19	22698862	missense	possibly damaging	0.90
R8470:Trpm3	UTSW	19	22910137	missense	possibly damaging	0.91
R8784:Trpm3	UTSW	19	22918676	missense	probably benign	0.07
R8816:Trpm3	UTSW	19	22988216	missense	probably damaging	0.97
R8818:Trpm3	UTSW	19	22978588	missense	possibly damaging	0.81
R8875:Trpm3	UTSW	19	22910129	missense	probably damaging	1.00
R8931:Trpm3	UTSW	19	22766670	missense	probably damaging	1.00
R8969:Trpm3	UTSW	19	22925944	missense	probably damaging	0.98
R8987:Trpm3	UTSW	19	22918760	missense	probably damaging	1.00
R9300:Trpm3	UTSW	19	22978381	missense	possibly damaging	0.49
R9327:Trpm3	UTSW	19	22918640	missense	possibly damaging	0.56
R9354:Trpm3	UTSW	19	22448332	missense	probably benign
Z1176:Trpm3	UTSW	19	22987490	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTCTGATGACAGATTGGGGACACAG -3'
(R):5'- TGCTGAAACAGACCGGAGAGTCAC -3'

Sequencing Primer
(F):5'- GAACTGCCTCTCCTCAAGAGTG -3'
(R):5'- AGAGTCACATGACAAACAAGTATTG -3'

Posted On

2014-04-13