Incidental Mutation 'R1523:Rnasel'
ID167597
Institutional Source Beutler Lab
Gene Symbol Rnasel
Ensembl Gene ENSMUSG00000066800
Gene Nameribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)
Synonyms2-5A-dependent RNAase, E230029I04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1523 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location153749426-153764221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 153756013 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 513 (Q513K)
Ref Sequence ENSEMBL: ENSMUSP00000138752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086209] [ENSMUST00000182538] [ENSMUST00000182722] [ENSMUST00000183241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086209
AA Change: Q513K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083385
Gene: ENSMUSG00000066800
AA Change: Q513K

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase 365 521 4.9e-19 PFAM
Pfam:Pkinase_Tyr 365 523 6.1e-14 PFAM
Pfam:Kdo 451 546 8e-8 PFAM
PUG 656 707 2.33e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182131
Predicted Effect probably benign
Transcript: ENSMUST00000182538
AA Change: Q5K

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138734
Gene: ENSMUSG00000066800
AA Change: Q5K

DomainStartEndE-ValueType
PUG 148 199 2.33e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182722
AA Change: Q513K

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138247
Gene: ENSMUSG00000066800
AA Change: Q513K

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase_Tyr 364 523 2.4e-13 PFAM
Pfam:Pkinase 365 520 2.1e-18 PFAM
Pfam:Kdo 452 546 9.3e-7 PFAM
Pfam:Ribonuc_2-5A 589 651 2.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183241
AA Change: Q513K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138752
Gene: ENSMUSG00000066800
AA Change: Q513K

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase_Tyr 364 523 2.6e-13 PFAM
Pfam:Pkinase 365 517 2.4e-18 PFAM
Pfam:Kdo 452 546 9.7e-7 PFAM
Pfam:Ribonuc_2-5A 589 674 1.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187415
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the interferon-regulated 2-5A system that functions in the antiviral and antiproliferative roles of interferons. Mutations in this gene have been associated with predisposition to prostate cancer and this gene is a candidate for the hereditary prostate cancer 1 (HPC1) allele. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an enlarged spleen and increased succeptibility to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
4930503B20Rik A G 3: 146,651,109 S15P probably damaging Het
4933402E13Rik T A X: 62,290,906 D177E probably benign Het
5530400C23Rik A G 6: 133,294,293 E100G possibly damaging Het
Abcg2 T C 6: 58,685,694 F507S possibly damaging Het
Adgrf5 A T 17: 43,450,153 Q913L probably benign Het
Ak7 A T 12: 105,766,608 N537I probably benign Het
Anks1 T A 17: 28,051,655 probably null Het
Arhgap32 T A 9: 32,256,752 V677D probably damaging Het
Arnt C T 3: 95,489,654 P466L possibly damaging Het
Arrb1 T G 7: 99,594,665 L274R probably damaging Het
Atf2 A T 2: 73,863,208 D3E probably damaging Het
Baz2b C T 2: 59,968,637 R381Q possibly damaging Het
Cacna1g C T 11: 94,442,729 probably null Het
Ccr10 C T 11: 101,173,675 R343Q probably damaging Het
Clca2 G T 3: 145,071,644 S822* probably null Het
Col12a1 A T 9: 79,660,996 Y1649N probably benign Het
Col23a1 G A 11: 51,561,916 probably null Het
Cp T C 3: 19,989,065 Y1006H probably benign Het
Ctbs A G 3: 146,454,980 T101A probably benign Het
Cyp4a31 T C 4: 115,569,754 F170L probably benign Het
Dock1 A C 7: 134,744,247 I173L possibly damaging Het
Dock4 A G 12: 40,693,025 D393G possibly damaging Het
Dsg1a T A 18: 20,322,317 S113T probably damaging Het
Epha3 T C 16: 63,610,948 D530G probably damaging Het
Erbb4 T A 1: 68,396,252 H162L possibly damaging Het
Fam131c C T 4: 141,382,831 T180I probably benign Het
Fndc1 A G 17: 7,773,209 S552P unknown Het
Foxf1 A G 8: 121,084,558 probably null Het
Frem2 T C 3: 53,655,407 T560A possibly damaging Het
Gabra4 G A 5: 71,633,632 T289M probably damaging Het
Gcnt1 A G 19: 17,329,833 V176A probably damaging Het
Gemin8 G A X: 166,180,648 S100N probably benign Het
Gm1527 T C 3: 28,920,418 I460T probably damaging Het
Gm6729 A G 10: 86,540,175 noncoding transcript Het
Gprin2 T C 14: 34,195,079 S245G probably benign Het
Gsdmc A T 15: 63,803,630 I112N probably damaging Het
Hspb6 A G 7: 30,553,423 D30G probably benign Het
Hydin A G 8: 110,533,271 D2625G probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Irf2 T A 8: 46,837,840 probably null Het
Kdm3b T C 18: 34,793,173 probably null Het
Khdc3 G A 9: 73,103,491 E208K possibly damaging Het
Kifc1 A T 17: 33,883,662 S263T probably benign Het
Lrig3 C A 10: 126,008,698 T677K probably damaging Het
Mapkapk3 A T 9: 107,263,623 probably null Het
Mertk T C 2: 128,790,328 probably null Het
Metrn A G 17: 25,794,977 *292R probably null Het
Mllt6 G T 11: 97,665,023 A60S probably damaging Het
Mmp21 T C 7: 133,679,045 I65M probably benign Het
Myo7b A G 18: 31,966,876 L1651P probably damaging Het
Nhsl1 A G 10: 18,408,355 S15G probably benign Het
Nos1ap T C 1: 170,338,118 D192G probably benign Het
Nrcam A G 12: 44,572,249 T844A probably damaging Het
Pax4 A G 6: 28,444,841 L203P probably damaging Het
Pbld2 T C 10: 63,076,433 I280T probably benign Het
Pclo A G 5: 14,788,406 Y4681C unknown Het
Phyhip T A 14: 70,461,760 M1K probably null Het
Plppr4 T C 3: 117,322,841 N456D probably damaging Het
Prpf31 T C 7: 3,640,857 Y473H probably damaging Het
Rapgef2 A T 3: 79,092,749 V564D probably damaging Het
Rexo1 T C 10: 80,542,751 S1123G probably benign Het
Rnf165 G A 18: 77,462,938 T98I probably benign Het
Rnf213 T C 11: 119,441,888 V2641A probably damaging Het
Rnf40 G T 7: 127,590,615 R184L probably damaging Het
Rnf8 A G 17: 29,626,972 K179R probably damaging Het
Sipa1l2 C T 8: 125,447,613 D1309N possibly damaging Het
Slc25a38 T A 9: 120,123,703 M307K possibly damaging Het
Snx33 T C 9: 56,926,182 D201G possibly damaging Het
Sulf1 T A 1: 12,817,350 Y249* probably null Het
Sult2a4 G A 7: 13,909,860 Q261* probably null Het
Syndig1 G A 2: 150,003,234 A226T probably damaging Het
Tcaf2 C T 6: 42,624,451 W891* probably null Het
Tcf15 C A 2: 152,143,888 T88K probably damaging Het
Tmem19 A T 10: 115,347,217 M117K probably damaging Het
Trim32 T C 4: 65,614,004 L266P probably benign Het
Vmn2r11 T C 5: 109,053,841 I266V probably benign Het
Vmn2r73 A T 7: 85,870,278 Y491N probably benign Het
Wrn C T 8: 33,292,716 E486K probably benign Het
Zfp457 T C 13: 67,293,437 E262G probably damaging Het
Zfp598 A G 17: 24,678,629 D308G probably null Het
Zufsp T C 10: 33,927,440 I549M probably damaging Het
Other mutations in Rnasel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Rnasel APN 1 153758384 missense probably benign 0.04
IGL02662:Rnasel APN 1 153754111 missense probably damaging 1.00
IGL03215:Rnasel APN 1 153758555 missense probably damaging 1.00
R0022:Rnasel UTSW 1 153760775 missense probably damaging 1.00
R0022:Rnasel UTSW 1 153760775 missense probably damaging 1.00
R0028:Rnasel UTSW 1 153754719 missense probably benign 0.04
R0116:Rnasel UTSW 1 153754512 missense probably damaging 1.00
R0981:Rnasel UTSW 1 153759599 missense probably benign 0.03
R1538:Rnasel UTSW 1 153760794 missense possibly damaging 0.62
R1646:Rnasel UTSW 1 153755054 missense probably damaging 1.00
R1793:Rnasel UTSW 1 153754423 missense probably damaging 0.98
R1843:Rnasel UTSW 1 153754674 missense possibly damaging 0.94
R2158:Rnasel UTSW 1 153754901 missense probably damaging 1.00
R2434:Rnasel UTSW 1 153754650 missense probably damaging 1.00
R2895:Rnasel UTSW 1 153760776 missense probably damaging 1.00
R4107:Rnasel UTSW 1 153754796 missense probably benign 0.00
R5013:Rnasel UTSW 1 153753931 missense probably damaging 0.99
R5015:Rnasel UTSW 1 153754097 nonsense probably null
R5540:Rnasel UTSW 1 153755144 nonsense probably null
R5688:Rnasel UTSW 1 153753706 start gained probably benign
R5955:Rnasel UTSW 1 153754400 missense probably benign 0.05
R6131:Rnasel UTSW 1 153754460 missense probably damaging 1.00
R6164:Rnasel UTSW 1 153754392 missense probably benign 0.32
R6395:Rnasel UTSW 1 153762121 missense probably damaging 0.99
R6483:Rnasel UTSW 1 153754686 missense probably benign 0.10
R7470:Rnasel UTSW 1 153754031 missense probably benign 0.00
R7538:Rnasel UTSW 1 153754560 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTCCTGCCCTTGATAGATGCCTAC -3'
(R):5'- AGTGAAAGGTGACTCCACACCAGC -3'

Sequencing Primer
(F):5'- ctctctctctctctctctctctc -3'
(R):5'- GACAGATGGAAATGCCATTGTCTAC -3'
Posted On2014-04-13