Mutagenetix > Incidental Mutation

Incidental Mutation 'R1523:Mertk'

167603

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R1523 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 128790328 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

AlphaFold

Q60805

Predicted Effect

probably null
Transcript: ENSMUST00000014505

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140221

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.3%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L24Rik	G	T	11: 83,440,406	E48*	probably null	Het
4930503B20Rik	A	G	3: 146,651,109	S15P	probably damaging	Het
4933402E13Rik	T	A	X: 62,290,906	D177E	probably benign	Het
5530400C23Rik	A	G	6: 133,294,293	E100G	possibly damaging	Het
Abcg2	T	C	6: 58,685,694	F507S	possibly damaging	Het
Adgrf5	A	T	17: 43,450,153	Q913L	probably benign	Het
Ak7	A	T	12: 105,766,608	N537I	probably benign	Het
Anks1	T	A	17: 28,051,655		probably null	Het
Arhgap32	T	A	9: 32,256,752	V677D	probably damaging	Het
Arnt	C	T	3: 95,489,654	P466L	possibly damaging	Het
Arrb1	T	G	7: 99,594,665	L274R	probably damaging	Het
Atf2	A	T	2: 73,863,208	D3E	probably damaging	Het
Baz2b	C	T	2: 59,968,637	R381Q	possibly damaging	Het
Cacna1g	C	T	11: 94,442,729		probably null	Het
Ccr10	C	T	11: 101,173,675	R343Q	probably damaging	Het
Clca2	G	T	3: 145,071,644	S822*	probably null	Het
Col12a1	A	T	9: 79,660,996	Y1649N	probably benign	Het
Col23a1	G	A	11: 51,561,916		probably null	Het
Cp	T	C	3: 19,989,065	Y1006H	probably benign	Het
Ctbs	A	G	3: 146,454,980	T101A	probably benign	Het
Cyp4a31	T	C	4: 115,569,754	F170L	probably benign	Het
Dock1	A	C	7: 134,744,247	I173L	possibly damaging	Het
Dock4	A	G	12: 40,693,025	D393G	possibly damaging	Het
Dsg1a	T	A	18: 20,322,317	S113T	probably damaging	Het
Epha3	T	C	16: 63,610,948	D530G	probably damaging	Het
Erbb4	T	A	1: 68,396,252	H162L	possibly damaging	Het
Fam131c	C	T	4: 141,382,831	T180I	probably benign	Het
Fndc1	A	G	17: 7,773,209	S552P	unknown	Het
Foxf1	A	G	8: 121,084,558		probably null	Het
Frem2	T	C	3: 53,655,407	T560A	possibly damaging	Het
Gabra4	G	A	5: 71,633,632	T289M	probably damaging	Het
Gcnt1	A	G	19: 17,329,833	V176A	probably damaging	Het
Gemin8	G	A	X: 166,180,648	S100N	probably benign	Het
Gm1527	T	C	3: 28,920,418	I460T	probably damaging	Het
Gm6729	A	G	10: 86,540,175		noncoding transcript	Het
Gprin2	T	C	14: 34,195,079	S245G	probably benign	Het
Gsdmc	A	T	15: 63,803,630	I112N	probably damaging	Het
Hspb6	A	G	7: 30,553,423	D30G	probably benign	Het
Hydin	A	G	8: 110,533,271	D2625G	probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Irf2	T	A	8: 46,837,840		probably null	Het
Kdm3b	T	C	18: 34,793,173		probably null	Het
Khdc3	G	A	9: 73,103,491	E208K	possibly damaging	Het
Kifc1	A	T	17: 33,883,662	S263T	probably benign	Het
Lrig3	C	A	10: 126,008,698	T677K	probably damaging	Het
Mapkapk3	A	T	9: 107,263,623		probably null	Het
Metrn	A	G	17: 25,794,977	*292R	probably null	Het
Mllt6	G	T	11: 97,665,023	A60S	probably damaging	Het
Mmp21	T	C	7: 133,679,045	I65M	probably benign	Het
Myo7b	A	G	18: 31,966,876	L1651P	probably damaging	Het
Nhsl1	A	G	10: 18,408,355	S15G	probably benign	Het
Nos1ap	T	C	1: 170,338,118	D192G	probably benign	Het
Nrcam	A	G	12: 44,572,249	T844A	probably damaging	Het
Pax4	A	G	6: 28,444,841	L203P	probably damaging	Het
Pbld2	T	C	10: 63,076,433	I280T	probably benign	Het
Pclo	A	G	5: 14,788,406	Y4681C	unknown	Het
Phyhip	T	A	14: 70,461,760	M1K	probably null	Het
Plppr4	T	C	3: 117,322,841	N456D	probably damaging	Het
Prpf31	T	C	7: 3,640,857	Y473H	probably damaging	Het
Rapgef2	A	T	3: 79,092,749	V564D	probably damaging	Het
Rexo1	T	C	10: 80,542,751	S1123G	probably benign	Het
Rnasel	C	A	1: 153,756,013	Q513K	probably damaging	Het
Rnf165	G	A	18: 77,462,938	T98I	probably benign	Het
Rnf213	T	C	11: 119,441,888	V2641A	probably damaging	Het
Rnf40	G	T	7: 127,590,615	R184L	probably damaging	Het
Rnf8	A	G	17: 29,626,972	K179R	probably damaging	Het
Sipa1l2	C	T	8: 125,447,613	D1309N	possibly damaging	Het
Slc25a38	T	A	9: 120,123,703	M307K	possibly damaging	Het
Snx33	T	C	9: 56,926,182	D201G	possibly damaging	Het
Sulf1	T	A	1: 12,817,350	Y249*	probably null	Het
Sult2a4	G	A	7: 13,909,860	Q261*	probably null	Het
Syndig1	G	A	2: 150,003,234	A226T	probably damaging	Het
Tcaf2	C	T	6: 42,624,451	W891*	probably null	Het
Tcf15	C	A	2: 152,143,888	T88K	probably damaging	Het
Tmem19	A	T	10: 115,347,217	M117K	probably damaging	Het
Trim32	T	C	4: 65,614,004	L266P	probably benign	Het
Vmn2r11	T	C	5: 109,053,841	I266V	probably benign	Het
Vmn2r73	A	T	7: 85,870,278	Y491N	probably benign	Het
Wrn	C	T	8: 33,292,716	E486K	probably benign	Het
Zfp457	T	C	13: 67,293,437	E262G	probably damaging	Het
Zfp598	A	G	17: 24,678,629	D308G	probably null	Het
Zufsp	T	C	10: 33,927,440	I549M	probably damaging	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
R8953:Mertk	UTSW	2	128778796	intron	probably benign
R9135:Mertk	UTSW	2	128762115	missense	probably benign	0.23
R9153:Mertk	UTSW	2	128782567	missense	probably damaging	1.00
R9176:Mertk	UTSW	2	128778972	missense	possibly damaging	0.62
R9443:Mertk	UTSW	2	128762109	missense	probably benign	0.00
R9574:Mertk	UTSW	2	128751960	missense	probably benign	0.03
R9582:Mertk	UTSW	2	128782607	missense	possibly damaging	0.55
R9616:Mertk	UTSW	2	128801335	missense	probably benign	0.01
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGAGAGTAGCTTGCCAGCTTTTCC -3'
(R):5'- AAAGATCAAGCGCCTAGTGCCC -3'

Sequencing Primer
(F):5'- TGCCAGCTTTTCCTTCTAAATG -3'
(R):5'- TAGTGCCCCTAGCCTAGTGAC -3'

Posted On

2014-04-13