Incidental Mutation 'R1523:Snx33'
ID167642
Institutional Source Beutler Lab
Gene Symbol Snx33
Ensembl Gene ENSMUSG00000032733
Gene Namesorting nexin 33
SynonymsSh3px3, E130307J07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1523 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location56917193-56928371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56926182 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 201 (D201G)
Ref Sequence ENSEMBL: ENSMUSP00000060225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050916]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050916
AA Change: D201G

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000060225
Gene: ENSMUSG00000032733
AA Change: D201G

DomainStartEndE-ValueType
SH3 3 60 3.2e-15 SMART
low complexity region 111 122 N/A INTRINSIC
PX 227 336 6.69e-18 SMART
Pfam:BAR_3_WASP_bdg 337 572 1.1e-113 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cytoskeletal reorganization, vesicle trafficking, endocytosis, and mitosis. The encoded protein is essential for the creation of the cleavage furrow during mitosis and for completion of mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
4930503B20Rik A G 3: 146,651,109 S15P probably damaging Het
4933402E13Rik T A X: 62,290,906 D177E probably benign Het
5530400C23Rik A G 6: 133,294,293 E100G possibly damaging Het
Abcg2 T C 6: 58,685,694 F507S possibly damaging Het
Adgrf5 A T 17: 43,450,153 Q913L probably benign Het
Ak7 A T 12: 105,766,608 N537I probably benign Het
Anks1 T A 17: 28,051,655 probably null Het
Arhgap32 T A 9: 32,256,752 V677D probably damaging Het
Arnt C T 3: 95,489,654 P466L possibly damaging Het
Arrb1 T G 7: 99,594,665 L274R probably damaging Het
Atf2 A T 2: 73,863,208 D3E probably damaging Het
Baz2b C T 2: 59,968,637 R381Q possibly damaging Het
Cacna1g C T 11: 94,442,729 probably null Het
Ccr10 C T 11: 101,173,675 R343Q probably damaging Het
Clca2 G T 3: 145,071,644 S822* probably null Het
Col12a1 A T 9: 79,660,996 Y1649N probably benign Het
Col23a1 G A 11: 51,561,916 probably null Het
Cp T C 3: 19,989,065 Y1006H probably benign Het
Ctbs A G 3: 146,454,980 T101A probably benign Het
Cyp4a31 T C 4: 115,569,754 F170L probably benign Het
Dock1 A C 7: 134,744,247 I173L possibly damaging Het
Dock4 A G 12: 40,693,025 D393G possibly damaging Het
Dsg1a T A 18: 20,322,317 S113T probably damaging Het
Epha3 T C 16: 63,610,948 D530G probably damaging Het
Erbb4 T A 1: 68,396,252 H162L possibly damaging Het
Fam131c C T 4: 141,382,831 T180I probably benign Het
Fndc1 A G 17: 7,773,209 S552P unknown Het
Foxf1 A G 8: 121,084,558 probably null Het
Frem2 T C 3: 53,655,407 T560A possibly damaging Het
Gabra4 G A 5: 71,633,632 T289M probably damaging Het
Gcnt1 A G 19: 17,329,833 V176A probably damaging Het
Gemin8 G A X: 166,180,648 S100N probably benign Het
Gm1527 T C 3: 28,920,418 I460T probably damaging Het
Gm6729 A G 10: 86,540,175 noncoding transcript Het
Gprin2 T C 14: 34,195,079 S245G probably benign Het
Gsdmc A T 15: 63,803,630 I112N probably damaging Het
Hspb6 A G 7: 30,553,423 D30G probably benign Het
Hydin A G 8: 110,533,271 D2625G probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Irf2 T A 8: 46,837,840 probably null Het
Kdm3b T C 18: 34,793,173 probably null Het
Khdc3 G A 9: 73,103,491 E208K possibly damaging Het
Kifc1 A T 17: 33,883,662 S263T probably benign Het
Lrig3 C A 10: 126,008,698 T677K probably damaging Het
Mapkapk3 A T 9: 107,263,623 probably null Het
Mertk T C 2: 128,790,328 probably null Het
Metrn A G 17: 25,794,977 *292R probably null Het
Mllt6 G T 11: 97,665,023 A60S probably damaging Het
Mmp21 T C 7: 133,679,045 I65M probably benign Het
Myo7b A G 18: 31,966,876 L1651P probably damaging Het
Nhsl1 A G 10: 18,408,355 S15G probably benign Het
Nos1ap T C 1: 170,338,118 D192G probably benign Het
Nrcam A G 12: 44,572,249 T844A probably damaging Het
Pax4 A G 6: 28,444,841 L203P probably damaging Het
Pbld2 T C 10: 63,076,433 I280T probably benign Het
Pclo A G 5: 14,788,406 Y4681C unknown Het
Phyhip T A 14: 70,461,760 M1K probably null Het
Plppr4 T C 3: 117,322,841 N456D probably damaging Het
Prpf31 T C 7: 3,640,857 Y473H probably damaging Het
Rapgef2 A T 3: 79,092,749 V564D probably damaging Het
Rexo1 T C 10: 80,542,751 S1123G probably benign Het
Rnasel C A 1: 153,756,013 Q513K probably damaging Het
Rnf165 G A 18: 77,462,938 T98I probably benign Het
Rnf213 T C 11: 119,441,888 V2641A probably damaging Het
Rnf40 G T 7: 127,590,615 R184L probably damaging Het
Rnf8 A G 17: 29,626,972 K179R probably damaging Het
Sipa1l2 C T 8: 125,447,613 D1309N possibly damaging Het
Slc25a38 T A 9: 120,123,703 M307K possibly damaging Het
Sulf1 T A 1: 12,817,350 Y249* probably null Het
Sult2a4 G A 7: 13,909,860 Q261* probably null Het
Syndig1 G A 2: 150,003,234 A226T probably damaging Het
Tcaf2 C T 6: 42,624,451 W891* probably null Het
Tcf15 C A 2: 152,143,888 T88K probably damaging Het
Tmem19 A T 10: 115,347,217 M117K probably damaging Het
Trim32 T C 4: 65,614,004 L266P probably benign Het
Vmn2r11 T C 5: 109,053,841 I266V probably benign Het
Vmn2r73 A T 7: 85,870,278 Y491N probably benign Het
Wrn C T 8: 33,292,716 E486K probably benign Het
Zfp457 T C 13: 67,293,437 E262G probably damaging Het
Zfp598 A G 17: 24,678,629 D308G probably null Het
Zufsp T C 10: 33,927,440 I549M probably damaging Het
Other mutations in Snx33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Snx33 APN 9 56926578 missense probably benign
IGL02646:Snx33 APN 9 56926759 missense probably damaging 1.00
IGL03028:Snx33 APN 9 56926451 missense probably benign
R0206:Snx33 UTSW 9 56926224 missense probably damaging 1.00
R0755:Snx33 UTSW 9 56925457 missense possibly damaging 0.84
R1218:Snx33 UTSW 9 56925985 missense probably damaging 1.00
R1627:Snx33 UTSW 9 56925957 missense probably damaging 1.00
R1758:Snx33 UTSW 9 56926698 missense probably benign 0.29
R1856:Snx33 UTSW 9 56926011 missense possibly damaging 0.85
R1885:Snx33 UTSW 9 56925837 missense probably benign 0.42
R2113:Snx33 UTSW 9 56926440 missense probably benign 0.28
R2422:Snx33 UTSW 9 56918538 missense probably benign 0.03
R3789:Snx33 UTSW 9 56918560 missense probably benign 0.00
R3870:Snx33 UTSW 9 56926740 missense probably benign 0.05
R3871:Snx33 UTSW 9 56926740 missense probably benign 0.05
R4734:Snx33 UTSW 9 56925901 missense possibly damaging 0.84
R4884:Snx33 UTSW 9 56926180 missense probably damaging 0.99
R5069:Snx33 UTSW 9 56926191 missense probably damaging 0.97
R5555:Snx33 UTSW 9 56925397 missense probably benign
R6153:Snx33 UTSW 9 56926699 missense possibly damaging 0.74
R7178:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7179:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7315:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7414:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7593:Snx33 UTSW 9 56926774 missense possibly damaging 0.52
R7607:Snx33 UTSW 9 56926713 missense probably benign
R7632:Snx33 UTSW 9 56926418 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGGGCACTGAGATCACTGTGAAC -3'
(R):5'- CCAACCAGCATATGGCTTTCCGAC -3'

Sequencing Primer
(F):5'- CACTGAGATCACTGTGAACTTGTG -3'
(R):5'- ATATGGCTTTCCGACCCAAGG -3'
Posted On2014-04-13