Incidental Mutation 'R1523:Adgrf5'
ID167676
Institutional Source Beutler Lab
Gene Symbol Adgrf5
Ensembl Gene ENSMUSG00000056492
Gene Nameadhesion G protein-coupled receptor F5
SynonymsGpr116, 8430401C09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1523 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location43360451-43459557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43450153 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 913 (Q913L)
Ref Sequence ENSEMBL: ENSMUSP00000153049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113599] [ENSMUST00000225962] [ENSMUST00000226087]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082648
Predicted Effect probably benign
Transcript: ENSMUST00000113599
AA Change: Q913L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109229
Gene: ENSMUSG00000056492
AA Change: Q913L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:EGF 118 161 8e-14 BLAST
Pfam:SEA 165 263 9.2e-14 PFAM
IG 276 366 1.54e-4 SMART
Blast:IG_like 374 464 2e-31 BLAST
IG 475 561 1.04e-1 SMART
low complexity region 815 823 N/A INTRINSIC
GPS 949 1004 6.49e-16 SMART
Pfam:7tm_2 1011 1264 1.2e-35 PFAM
low complexity region 1328 1347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225962
AA Change: Q708L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000226087
AA Change: Q913L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased body weight and respiratory distress associated with pulmonary alveolar proteinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
4930503B20Rik A G 3: 146,651,109 S15P probably damaging Het
4933402E13Rik T A X: 62,290,906 D177E probably benign Het
5530400C23Rik A G 6: 133,294,293 E100G possibly damaging Het
Abcg2 T C 6: 58,685,694 F507S possibly damaging Het
Ak7 A T 12: 105,766,608 N537I probably benign Het
Anks1 T A 17: 28,051,655 probably null Het
Arhgap32 T A 9: 32,256,752 V677D probably damaging Het
Arnt C T 3: 95,489,654 P466L possibly damaging Het
Arrb1 T G 7: 99,594,665 L274R probably damaging Het
Atf2 A T 2: 73,863,208 D3E probably damaging Het
Baz2b C T 2: 59,968,637 R381Q possibly damaging Het
Cacna1g C T 11: 94,442,729 probably null Het
Ccr10 C T 11: 101,173,675 R343Q probably damaging Het
Clca2 G T 3: 145,071,644 S822* probably null Het
Col12a1 A T 9: 79,660,996 Y1649N probably benign Het
Col23a1 G A 11: 51,561,916 probably null Het
Cp T C 3: 19,989,065 Y1006H probably benign Het
Ctbs A G 3: 146,454,980 T101A probably benign Het
Cyp4a31 T C 4: 115,569,754 F170L probably benign Het
Dock1 A C 7: 134,744,247 I173L possibly damaging Het
Dock4 A G 12: 40,693,025 D393G possibly damaging Het
Dsg1a T A 18: 20,322,317 S113T probably damaging Het
Epha3 T C 16: 63,610,948 D530G probably damaging Het
Erbb4 T A 1: 68,396,252 H162L possibly damaging Het
Fam131c C T 4: 141,382,831 T180I probably benign Het
Fndc1 A G 17: 7,773,209 S552P unknown Het
Foxf1 A G 8: 121,084,558 probably null Het
Frem2 T C 3: 53,655,407 T560A possibly damaging Het
Gabra4 G A 5: 71,633,632 T289M probably damaging Het
Gcnt1 A G 19: 17,329,833 V176A probably damaging Het
Gemin8 G A X: 166,180,648 S100N probably benign Het
Gm1527 T C 3: 28,920,418 I460T probably damaging Het
Gm6729 A G 10: 86,540,175 noncoding transcript Het
Gprin2 T C 14: 34,195,079 S245G probably benign Het
Gsdmc A T 15: 63,803,630 I112N probably damaging Het
Hspb6 A G 7: 30,553,423 D30G probably benign Het
Hydin A G 8: 110,533,271 D2625G probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Irf2 T A 8: 46,837,840 probably null Het
Kdm3b T C 18: 34,793,173 probably null Het
Khdc3 G A 9: 73,103,491 E208K possibly damaging Het
Kifc1 A T 17: 33,883,662 S263T probably benign Het
Lrig3 C A 10: 126,008,698 T677K probably damaging Het
Mapkapk3 A T 9: 107,263,623 probably null Het
Mertk T C 2: 128,790,328 probably null Het
Metrn A G 17: 25,794,977 *292R probably null Het
Mllt6 G T 11: 97,665,023 A60S probably damaging Het
Mmp21 T C 7: 133,679,045 I65M probably benign Het
Myo7b A G 18: 31,966,876 L1651P probably damaging Het
Nhsl1 A G 10: 18,408,355 S15G probably benign Het
Nos1ap T C 1: 170,338,118 D192G probably benign Het
Nrcam A G 12: 44,572,249 T844A probably damaging Het
Pax4 A G 6: 28,444,841 L203P probably damaging Het
Pbld2 T C 10: 63,076,433 I280T probably benign Het
Pclo A G 5: 14,788,406 Y4681C unknown Het
Phyhip T A 14: 70,461,760 M1K probably null Het
Plppr4 T C 3: 117,322,841 N456D probably damaging Het
Prpf31 T C 7: 3,640,857 Y473H probably damaging Het
Rapgef2 A T 3: 79,092,749 V564D probably damaging Het
Rexo1 T C 10: 80,542,751 S1123G probably benign Het
Rnasel C A 1: 153,756,013 Q513K probably damaging Het
Rnf165 G A 18: 77,462,938 T98I probably benign Het
Rnf213 T C 11: 119,441,888 V2641A probably damaging Het
Rnf40 G T 7: 127,590,615 R184L probably damaging Het
Rnf8 A G 17: 29,626,972 K179R probably damaging Het
Sipa1l2 C T 8: 125,447,613 D1309N possibly damaging Het
Slc25a38 T A 9: 120,123,703 M307K possibly damaging Het
Snx33 T C 9: 56,926,182 D201G possibly damaging Het
Sulf1 T A 1: 12,817,350 Y249* probably null Het
Sult2a4 G A 7: 13,909,860 Q261* probably null Het
Syndig1 G A 2: 150,003,234 A226T probably damaging Het
Tcaf2 C T 6: 42,624,451 W891* probably null Het
Tcf15 C A 2: 152,143,888 T88K probably damaging Het
Tmem19 A T 10: 115,347,217 M117K probably damaging Het
Trim32 T C 4: 65,614,004 L266P probably benign Het
Vmn2r11 T C 5: 109,053,841 I266V probably benign Het
Vmn2r73 A T 7: 85,870,278 Y491N probably benign Het
Wrn C T 8: 33,292,716 E486K probably benign Het
Zfp457 T C 13: 67,293,437 E262G probably damaging Het
Zfp598 A G 17: 24,678,629 D308G probably null Het
Zufsp T C 10: 33,927,440 I549M probably damaging Het
Other mutations in Adgrf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Adgrf5 APN 17 43449915 missense possibly damaging 0.79
IGL00590:Adgrf5 APN 17 43453147 missense probably damaging 1.00
IGL01128:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01131:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01132:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01392:Adgrf5 APN 17 43450012 missense probably benign 0.00
IGL01475:Adgrf5 APN 17 43450354 missense probably benign 0.00
IGL01614:Adgrf5 APN 17 43424471 missense possibly damaging 0.53
IGL01654:Adgrf5 APN 17 43451170 missense possibly damaging 0.89
IGL02053:Adgrf5 APN 17 43450167 missense possibly damaging 0.47
IGL02175:Adgrf5 APN 17 43451010 missense probably damaging 1.00
IGL02416:Adgrf5 APN 17 43444980 splice site probably null
IGL02525:Adgrf5 APN 17 43449963 missense probably damaging 1.00
IGL03035:Adgrf5 APN 17 43430627 missense possibly damaging 0.80
duct_tape UTSW 17 43445115 missense probably benign 0.04
Flypaper UTSW 17 43422661 splice site probably benign
Heaped UTSW 17 43447036 missense possibly damaging 0.93
la_brea UTSW 17 43452323 critical splice donor site probably null
Motel UTSW 17 43450380 missense probably damaging 1.00
noel UTSW 17 43430612 missense probably damaging 1.00
Schmutzfinger UTSW 17 43424818 nonsense probably null
sticky UTSW 17 43437571 missense probably damaging 0.98
sweetie UTSW 17 43450983 missense probably damaging 0.96
PIT4812001:Adgrf5 UTSW 17 43450369 missense probably damaging 1.00
R0699:Adgrf5 UTSW 17 43422661 splice site probably null
R0972:Adgrf5 UTSW 17 43450983 missense probably damaging 0.96
R1521:Adgrf5 UTSW 17 43430552 missense probably benign 0.03
R1758:Adgrf5 UTSW 17 43424593 critical splice donor site probably null
R1767:Adgrf5 UTSW 17 43450564 missense possibly damaging 0.87
R1799:Adgrf5 UTSW 17 43440067 missense probably damaging 0.98
R1800:Adgrf5 UTSW 17 43451082 missense probably damaging 1.00
R1888:Adgrf5 UTSW 17 43427005 splice site probably null
R1888:Adgrf5 UTSW 17 43427005 splice site probably null
R2057:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2058:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2059:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2410:Adgrf5 UTSW 17 43455266 missense probably benign 0.11
R2568:Adgrf5 UTSW 17 43437671 missense probably damaging 1.00
R2847:Adgrf5 UTSW 17 43422640 missense possibly damaging 0.69
R2848:Adgrf5 UTSW 17 43422640 missense possibly damaging 0.69
R3800:Adgrf5 UTSW 17 43447060 splice site probably benign
R3856:Adgrf5 UTSW 17 43447036 missense possibly damaging 0.93
R4021:Adgrf5 UTSW 17 43430714 splice site probably benign
R4075:Adgrf5 UTSW 17 43450195 missense probably damaging 1.00
R4366:Adgrf5 UTSW 17 43441969 missense probably damaging 0.99
R4409:Adgrf5 UTSW 17 43441847 missense probably damaging 1.00
R4570:Adgrf5 UTSW 17 43445115 missense probably benign 0.04
R4616:Adgrf5 UTSW 17 43452440 missense probably benign 0.38
R4623:Adgrf5 UTSW 17 43450983 missense probably benign 0.16
R4645:Adgrf5 UTSW 17 43437525 missense probably damaging 1.00
R5211:Adgrf5 UTSW 17 43422620 missense probably benign 0.32
R5268:Adgrf5 UTSW 17 43450999 missense probably damaging 1.00
R5280:Adgrf5 UTSW 17 43426334 missense probably damaging 1.00
R5326:Adgrf5 UTSW 17 43440074 missense probably damaging 0.98
R5762:Adgrf5 UTSW 17 43430695 missense probably null 0.16
R5856:Adgrf5 UTSW 17 43446120 missense probably benign 0.09
R6007:Adgrf5 UTSW 17 43437571 missense probably damaging 0.98
R6153:Adgrf5 UTSW 17 43451083 missense possibly damaging 0.96
R6451:Adgrf5 UTSW 17 43424818 nonsense probably null
R6535:Adgrf5 UTSW 17 43440029 missense probably benign 0.05
R6536:Adgrf5 UTSW 17 43422661 splice site probably benign
R6602:Adgrf5 UTSW 17 43450304 missense probably benign 0.32
R6882:Adgrf5 UTSW 17 43450380 missense probably damaging 1.00
R6992:Adgrf5 UTSW 17 43452323 critical splice donor site probably null
R7137:Adgrf5 UTSW 17 43450897 missense probably damaging 1.00
R7170:Adgrf5 UTSW 17 43446138 missense possibly damaging 0.92
R7313:Adgrf5 UTSW 17 43445083 missense probably benign 0.01
R7313:Adgrf5 UTSW 17 43452477 critical splice donor site probably null
R7331:Adgrf5 UTSW 17 43437593 missense probably damaging 0.99
R7346:Adgrf5 UTSW 17 43451179 missense probably damaging 1.00
R7350:Adgrf5 UTSW 17 43428444 critical splice acceptor site probably null
R7667:Adgrf5 UTSW 17 43446039 missense probably benign 0.01
R7717:Adgrf5 UTSW 17 43450753 missense probably damaging 1.00
R7731:Adgrf5 UTSW 17 43450560 missense probably damaging 1.00
R7877:Adgrf5 UTSW 17 43441838 missense possibly damaging 0.63
R7950:Adgrf5 UTSW 17 43451157 missense probably damaging 0.99
R7988:Adgrf5 UTSW 17 43439813 intron probably benign
R8188:Adgrf5 UTSW 17 43430612 missense probably damaging 1.00
R8219:Adgrf5 UTSW 17 43449859 missense probably benign 0.13
R8284:Adgrf5 UTSW 17 43455270 missense unknown
R8460:Adgrf5 UTSW 17 43439808 intron probably benign
R8504:Adgrf5 UTSW 17 43446949 missense probably benign 0.01
R8751:Adgrf5 UTSW 17 43437683 missense possibly damaging 0.80
R8852:Adgrf5 UTSW 17 43453098 missense possibly damaging 0.82
X0017:Adgrf5 UTSW 17 43427045 missense probably damaging 1.00
Z1177:Adgrf5 UTSW 17 43445053 missense probably benign 0.00
Z1191:Adgrf5 UTSW 17 43445035 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGGAAAGGTTTTCCCAAGCCCTC -3'
(R):5'- CAACTAGACAGGCAGCTAAGCTGAC -3'

Sequencing Primer
(F):5'- ACCCTAACGTTCAGATGAAGAG -3'
(R):5'- GTGGTTACACTTGCAGAAGACTC -3'
Posted On2014-04-13