Incidental Mutation 'R1524:Pi15'
ID 167685
Institutional Source Beutler Lab
Gene Symbol Pi15
Ensembl Gene ENSMUSG00000067780
Gene Name peptidase inhibitor 15
Synonyms P25TI, P24TI, SugarCrisp
MMRRC Submission 039565-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1524 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 17672125-17701163 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17690076 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 126 (S126P)
Ref Sequence ENSEMBL: ENSMUSP00000085826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088476]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000088476
AA Change: S126P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000085826
Gene: ENSMUSG00000067780
AA Change: S126P

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SCP 76 230 9.32e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186267
Meta Mutation Damage Score 0.0841 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsin inhibitor. The protein shares similarity to insect venom allergens, mammalian testis-specific proteins and plant pathogenesis-related proteins. It is frequently expressed in human neuroblastoma and glioblastoma cell lines, and thus may play a role in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 88,119,548 (GRCm39) V102L probably benign Het
Adck1 T C 12: 88,368,854 (GRCm39) Y111H probably damaging Het
Adcy10 G T 1: 165,345,972 (GRCm39) K340N probably damaging Het
Aebp1 T C 11: 5,820,089 (GRCm39) V355A probably damaging Het
Atp2b2 T C 6: 113,751,162 (GRCm39) probably benign Het
Atrn T C 2: 130,799,000 (GRCm39) V390A probably benign Het
Bpifc T A 10: 85,813,599 (GRCm39) Q315L probably benign Het
C1qtnf6 T G 15: 78,409,092 (GRCm39) probably null Het
Cab39l A G 14: 59,757,186 (GRCm39) probably benign Het
Capn12 T A 7: 28,582,189 (GRCm39) probably benign Het
Ceacam18 A C 7: 43,288,779 (GRCm39) T177P possibly damaging Het
Ces5a A T 8: 94,252,293 (GRCm39) F200I probably damaging Het
Cldn19 G T 4: 119,114,248 (GRCm39) probably null Het
Cntnap2 A G 6: 46,507,613 (GRCm39) S46P probably damaging Het
Dchs1 A G 7: 105,413,732 (GRCm39) Y1028H probably damaging Het
Exd1 A T 2: 119,355,155 (GRCm39) F253L probably damaging Het
Fam161a A G 11: 22,965,826 (GRCm39) N40D possibly damaging Het
Fam81a A T 9: 70,032,390 (GRCm39) I34N probably damaging Het
Fchsd1 A C 18: 38,098,950 (GRCm39) probably null Het
Fut11 T A 14: 20,746,234 (GRCm39) F359I possibly damaging Het
Fut7 T C 2: 25,315,159 (GRCm39) V92A probably damaging Het
Grid2 C G 6: 64,406,738 (GRCm39) F699L possibly damaging Het
Grin2a A G 16: 9,481,467 (GRCm39) S445P possibly damaging Het
H2al2b A C Y: 2,720,391 (GRCm39) F95C probably damaging Het
Hecw2 T C 1: 53,890,777 (GRCm39) D1246G probably damaging Het
Ifit1 A G 19: 34,625,032 (GRCm39) N56S probably damaging Het
Ldb3 C A 14: 34,277,313 (GRCm39) V354L probably benign Het
Lrig2 T C 3: 104,371,192 (GRCm39) Y479C probably benign Het
Ltn1 A G 16: 87,178,444 (GRCm39) V1595A probably damaging Het
Macf1 A G 4: 123,326,323 (GRCm39) V2939A possibly damaging Het
Mapre3 T G 5: 31,019,261 (GRCm39) I35S probably damaging Het
Med16 A T 10: 79,734,150 (GRCm39) L588Q probably damaging Het
Ncapg2 T C 12: 116,398,198 (GRCm39) probably benign Het
Ncstn C A 1: 171,899,716 (GRCm39) R322L possibly damaging Het
Ndst1 A T 18: 60,831,576 (GRCm39) I594N probably damaging Het
Ndst3 A G 3: 123,342,555 (GRCm39) I752T possibly damaging Het
Obscn G T 11: 59,006,681 (GRCm39) S1185R probably damaging Het
Or5b112 T A 19: 13,319,486 (GRCm39) C121* probably null Het
Or6aa1 A G 7: 86,044,020 (GRCm39) S229P probably benign Het
Or9q1 A T 19: 13,805,679 (GRCm39) L27H probably damaging Het
Otof T A 5: 30,536,900 (GRCm39) D1285V probably benign Het
Pcnx2 A G 8: 126,617,880 (GRCm39) I125T probably benign Het
Pde4a T C 9: 21,112,543 (GRCm39) S240P probably damaging Het
Pkhd1 T C 1: 20,188,004 (GRCm39) S3435G probably damaging Het
Plin1 C A 7: 79,376,338 (GRCm39) V133L probably benign Het
Pnpt1 T A 11: 29,080,776 (GRCm39) C7S unknown Het
Ppp3ca A T 3: 136,503,579 (GRCm39) M51L probably benign Het
Primpol G T 8: 47,039,502 (GRCm39) probably benign Het
Prlr T C 15: 10,319,419 (GRCm39) V116A probably damaging Het
Ptgr3 A G 18: 84,112,831 (GRCm39) E169G probably benign Het
Rnf139 A G 15: 58,761,266 (GRCm39) D35G probably damaging Het
Rsbn1l T A 5: 21,156,671 (GRCm39) K38M probably damaging Het
Ryr3 T A 2: 112,699,427 (GRCm39) I888F probably damaging Het
Sec16a C A 2: 26,318,394 (GRCm39) V1566F probably damaging Het
Sin3b A G 8: 73,479,915 (GRCm39) T874A probably benign Het
Skic3 T A 13: 76,286,491 (GRCm39) D891E probably benign Het
Slc5a5 A C 8: 71,344,978 (GRCm39) Y110D probably damaging Het
Smarcd2 C T 11: 106,157,978 (GRCm39) V97I probably benign Het
St6galnac2 G A 11: 116,575,313 (GRCm39) probably benign Het
Tbc1d22b T C 17: 29,789,585 (GRCm39) L149P probably damaging Het
Tekt2 T C 4: 126,217,442 (GRCm39) I208V probably benign Het
Tenm3 A G 8: 48,682,016 (GRCm39) I2522T possibly damaging Het
Ttll5 T A 12: 85,911,342 (GRCm39) Y233* probably null Het
Vcpip1 C T 1: 9,794,727 (GRCm39) E1215K probably damaging Het
Wdr4 T C 17: 31,728,737 (GRCm39) probably benign Het
Zfp703 G A 8: 27,469,401 (GRCm39) G355D probably damaging Het
Zfp830 T A 11: 82,655,794 (GRCm39) D199E probably damaging Het
Other mutations in Pi15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Pi15 APN 1 17,691,747 (GRCm39) missense probably damaging 1.00
IGL00844:Pi15 APN 1 17,691,764 (GRCm39) splice site probably benign
IGL03388:Pi15 APN 1 17,673,001 (GRCm39) missense probably benign
R0554:Pi15 UTSW 1 17,691,872 (GRCm39) missense probably benign 0.06
R0578:Pi15 UTSW 1 17,673,073 (GRCm39) nonsense probably null
R1665:Pi15 UTSW 1 17,691,726 (GRCm39) missense probably damaging 1.00
R1791:Pi15 UTSW 1 17,672,945 (GRCm39) missense probably benign 0.02
R4767:Pi15 UTSW 1 17,672,990 (GRCm39) missense probably benign
R7804:Pi15 UTSW 1 17,695,137 (GRCm39) nonsense probably null
R7850:Pi15 UTSW 1 17,673,105 (GRCm39) nonsense probably null
R8914:Pi15 UTSW 1 17,691,962 (GRCm39) missense probably damaging 1.00
R8974:Pi15 UTSW 1 17,691,675 (GRCm39) missense possibly damaging 0.82
R8977:Pi15 UTSW 1 17,690,126 (GRCm39) critical splice donor site probably null
R9254:Pi15 UTSW 1 17,695,180 (GRCm39) missense probably benign 0.00
R9567:Pi15 UTSW 1 17,695,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAAGACTGGAAGTAGGAGCACCATT -3'
(R):5'- TGGAAAGCAGGACACAGCATACAC -3'

Sequencing Primer
(F):5'- GAAGTAGGAGCACCATTTCTTTC -3'
(R):5'- gctccaaacttagtctcagtaactc -3'
Posted On 2014-04-13