Mutagenetix > Incidental Mutation

Incidental Mutation 'R1524:Hecw2'

167687

Institutional Source

Beutler Lab

Gene Symbol

Hecw2

Ensembl Gene

ENSMUSG00000042807

Gene Name

HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2

Synonyms

A730039N16Rik, Nedl2, D030049F17Rik

MMRRC Submission

039565-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.188) question?

Stock #

R1524 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53806876-54195168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53851618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1246 (D1246G)

Ref Sequence

ENSEMBL: ENSMUSP00000113283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000120904]

AlphaFold

Q6I6G8

Predicted Effect

probably damaging
Transcript: ENSMUST00000087659
AA Change: D1246G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807
AA Change: D1246G

Domain	Start	End	E-Value	Type
Pfam:HECW_N	45	164	4.6e-62	PFAM
low complexity region	165	178	N/A	INTRINSIC
C2	186	297	2.19e-12	SMART
low complexity region	577	596	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	746	755	N/A	INTRINSIC
low complexity region	769	786	N/A	INTRINSIC
WW	814	846	1.21e-11	SMART
coiled coil region	853	880	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
WW	992	1024	2.12e-7	SMART
Blast:HECTc	1111	1183	2e-23	BLAST
HECTc	1241	1578	8.02e-183	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120904
AA Change: D1246G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807
AA Change: D1246G

Domain	Start	End	E-Value	Type
PDB:2LFE\|A	42	162	6e-80	PDB
low complexity region	165	178	N/A	INTRINSIC
C2	186	297	2.19e-12	SMART
low complexity region	577	596	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	746	755	N/A	INTRINSIC
low complexity region	769	786	N/A	INTRINSIC
WW	814	846	1.21e-11	SMART
coiled coil region	853	880	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
WW	992	1024	2.12e-7	SMART
Blast:HECTc	1111	1183	2e-23	BLAST
HECTc	1241	1578	8.02e-183	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152870

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184834

Meta Mutation Damage Score

0.7102

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	G	T	5: 87,971,689	V102L	probably benign	Het
Adck1	T	C	12: 88,402,084	Y111H	probably damaging	Het
Adcy10	G	T	1: 165,518,403	K340N	probably damaging	Het
Aebp1	T	C	11: 5,870,089	V355A	probably damaging	Het
Atp2b2	T	C	6: 113,774,201		probably benign	Het
Atrn	T	C	2: 130,957,080	V390A	probably benign	Het
Bpifc	T	A	10: 85,977,735	Q315L	probably benign	Het
C1qtnf6	T	G	15: 78,524,892		probably null	Het
Cab39l	A	G	14: 59,519,737		probably benign	Het
Capn12	T	A	7: 28,882,764		probably benign	Het
Ceacam18	A	C	7: 43,639,355	T177P	possibly damaging	Het
Ces5a	A	T	8: 93,525,665	F200I	probably damaging	Het
Cldn19	G	T	4: 119,257,051		probably null	Het
Cntnap2	A	G	6: 46,530,679	S46P	probably damaging	Het
Dchs1	A	G	7: 105,764,525	Y1028H	probably damaging	Het
Exd1	A	T	2: 119,524,674	F253L	probably damaging	Het
Fam161a	A	G	11: 23,015,826	N40D	possibly damaging	Het
Fam81a	A	T	9: 70,125,108	I34N	probably damaging	Het
Fchsd1	A	C	18: 37,965,897		probably null	Het
Fut11	T	A	14: 20,696,166	F359I	possibly damaging	Het
Fut7	T	C	2: 25,425,147	V92A	probably damaging	Het
Grid2	C	G	6: 64,429,754	F699L	possibly damaging	Het
Grin2a	A	G	16: 9,663,603	S445P	possibly damaging	Het
H2al2b	A	C	Y: 2,720,391	F95C	probably damaging	Het
Ifit1	A	G	19: 34,647,632	N56S	probably damaging	Het
Ldb3	C	A	14: 34,555,356	V354L	probably benign	Het
Lrig2	T	C	3: 104,463,876	Y479C	probably benign	Het
Ltn1	A	G	16: 87,381,556	V1595A	probably damaging	Het
Macf1	A	G	4: 123,432,530	V2939A	possibly damaging	Het
Mapre3	T	G	5: 30,861,917	I35S	probably damaging	Het
Med16	A	T	10: 79,898,316	L588Q	probably damaging	Het
Ncapg2	T	C	12: 116,434,578		probably benign	Het
Ncstn	C	A	1: 172,072,149	R322L	possibly damaging	Het
Ndst1	A	T	18: 60,698,504	I594N	probably damaging	Het
Ndst3	A	G	3: 123,548,906	I752T	possibly damaging	Het
Obscn	G	T	11: 59,115,855	S1185R	probably damaging	Het
Olfr1466	T	A	19: 13,342,122	C121*	probably null	Het
Olfr1500	A	T	19: 13,828,315	L27H	probably damaging	Het
Olfr303	A	G	7: 86,394,812	S229P	probably benign	Het
Otof	T	A	5: 30,379,556	D1285V	probably benign	Het
Pcnx2	A	G	8: 125,891,141	I125T	probably benign	Het
Pde4a	T	C	9: 21,201,247	S240P	probably damaging	Het
Pi15	T	C	1: 17,619,852	S126P	probably benign	Het
Pkhd1	T	C	1: 20,117,780	S3435G	probably damaging	Het
Plin1	C	A	7: 79,726,590	V133L	probably benign	Het
Pnpt1	T	A	11: 29,130,776	C7S	unknown	Het
Ppp3ca	A	T	3: 136,797,818	M51L	probably benign	Het
Primpol	G	T	8: 46,586,467		probably benign	Het
Prlr	T	C	15: 10,319,333	V116A	probably damaging	Het
Rnf139	A	G	15: 58,889,417	D35G	probably damaging	Het
Rsbn1l	T	A	5: 20,951,673	K38M	probably damaging	Het
Ryr3	T	A	2: 112,869,082	I888F	probably damaging	Het
Sec16a	C	A	2: 26,428,382	V1566F	probably damaging	Het
Sin3b	A	G	8: 72,753,287	T874A	probably benign	Het
Slc5a5	A	C	8: 70,892,334	Y110D	probably damaging	Het
Smarcd2	C	T	11: 106,267,152	V97I	probably benign	Het
St6galnac2	G	A	11: 116,684,487		probably benign	Het
Tbc1d22b	T	C	17: 29,570,611	L149P	probably damaging	Het
Tekt2	T	C	4: 126,323,649	I208V	probably benign	Het
Tenm3	A	G	8: 48,228,981	I2522T	possibly damaging	Het
Ttc37	T	A	13: 76,138,372	D891E	probably benign	Het
Ttll5	T	A	12: 85,864,568	Y233*	probably null	Het
Vcpip1	C	T	1: 9,724,502	E1215K	probably damaging	Het
Wdr4	T	C	17: 31,509,763		probably benign	Het
Zadh2	A	G	18: 84,094,706	E169G	probably benign	Het
Zfp703	G	A	8: 26,979,373	G355D	probably damaging	Het
Zfp830	T	A	11: 82,764,968	D199E	probably damaging	Het

Other mutations in Hecw2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Hecw2	APN	1	53830737	missense	probably damaging	1.00
IGL00338:Hecw2	APN	1	53827881	splice site	probably benign
IGL00530:Hecw2	APN	1	53853280	missense	probably damaging	1.00
IGL01343:Hecw2	APN	1	53826976	missense	probably damaging	0.96
IGL01503:Hecw2	APN	1	53826961	missense	probably damaging	1.00
IGL01989:Hecw2	APN	1	53840792	missense	probably damaging	1.00
IGL02016:Hecw2	APN	1	53831543	missense	possibly damaging	0.73
IGL02052:Hecw2	APN	1	53926511	missense	probably benign
IGL02085:Hecw2	APN	1	53942802	critical splice acceptor site	probably null
IGL02302:Hecw2	APN	1	53933248	missense	probably damaging	1.00
IGL02310:Hecw2	APN	1	53923916	missense	probably null	0.38
IGL02388:Hecw2	APN	1	53925699	missense	probably benign	0.17
IGL02499:Hecw2	APN	1	53926488	missense	probably benign
IGL02695:Hecw2	APN	1	53926209	missense	possibly damaging	0.94
IGL02732:Hecw2	APN	1	53926688	splice site	probably benign
IGL03100:Hecw2	APN	1	53831656	missense	probably damaging	1.00
IGL03175:Hecw2	APN	1	53926257	missense	possibly damaging	0.51
IGL03253:Hecw2	APN	1	53832716	missense	possibly damaging	0.85
IGL03356:Hecw2	APN	1	53927058	splice site	probably benign
Memoriam	UTSW	1	53926056	missense	probably benign
recollect	UTSW	1	53904422	missense	possibly damaging	0.88
ANU74:Hecw2	UTSW	1	53925694	missense	probably benign	0.01
R0077:Hecw2	UTSW	1	53868831	splice site	probably benign
R0133:Hecw2	UTSW	1	53830740	missense	probably damaging	1.00
R0268:Hecw2	UTSW	1	53926698	splice site	probably benign
R1303:Hecw2	UTSW	1	54040393	missense	probably benign	0.00
R1460:Hecw2	UTSW	1	53813245	missense	probably damaging	0.96
R1533:Hecw2	UTSW	1	53926545	splice site	probably null
R1828:Hecw2	UTSW	1	53926023	missense	probably benign
R2170:Hecw2	UTSW	1	53942797	missense	probably damaging	0.99
R2338:Hecw2	UTSW	1	53904422	missense	possibly damaging	0.88
R3016:Hecw2	UTSW	1	53830680	missense	probably damaging	1.00
R3872:Hecw2	UTSW	1	53832757	splice site	probably benign
R3892:Hecw2	UTSW	1	53926121	missense	probably benign	0.01
R4086:Hecw2	UTSW	1	53831656	missense	probably damaging	1.00
R4247:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4248:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4249:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4545:Hecw2	UTSW	1	53813222	makesense	probably null
R4805:Hecw2	UTSW	1	53840859	missense	probably damaging	1.00
R4834:Hecw2	UTSW	1	53830752	missense	probably damaging	1.00
R4884:Hecw2	UTSW	1	53950841	missense	probably benign	0.03
R4983:Hecw2	UTSW	1	53832671	missense	probably benign	0.42
R5168:Hecw2	UTSW	1	53913300	missense	probably damaging	1.00
R5482:Hecw2	UTSW	1	53926201	missense	probably benign	0.09
R5549:Hecw2	UTSW	1	53925691	missense	possibly damaging	0.91
R5623:Hecw2	UTSW	1	53832623	missense	probably null	1.00
R5740:Hecw2	UTSW	1	53887603	missense	probably benign	0.12
R5919:Hecw2	UTSW	1	53937090	missense	probably damaging	0.99
R6058:Hecw2	UTSW	1	53923976	missense	possibly damaging	0.67
R6460:Hecw2	UTSW	1	53868833	splice site	probably null
R6875:Hecw2	UTSW	1	53937132	missense	probably benign	0.01
R7097:Hecw2	UTSW	1	53865124	missense	possibly damaging	0.88
R7131:Hecw2	UTSW	1	53865121	missense	probably damaging	1.00
R7291:Hecw2	UTSW	1	53914594	missense	probably damaging	1.00
R7401:Hecw2	UTSW	1	53904343	missense	probably damaging	1.00
R7482:Hecw2	UTSW	1	54040470	missense	probably damaging	0.99
R7501:Hecw2	UTSW	1	53913872	critical splice acceptor site	probably null
R7520:Hecw2	UTSW	1	53926056	missense	probably benign
R7611:Hecw2	UTSW	1	53913300	missense	probably damaging	1.00
R8184:Hecw2	UTSW	1	54040387	missense	probably benign	0.37
R8286:Hecw2	UTSW	1	53840769	missense	probably damaging	1.00
R8300:Hecw2	UTSW	1	53887616	missense	probably null	0.07
R8354:Hecw2	UTSW	1	53925308	critical splice donor site	probably null
R8362:Hecw2	UTSW	1	54040491	start codon destroyed	probably null	0.51
R8691:Hecw2	UTSW	1	53865064	missense	probably benign	0.26
R8745:Hecw2	UTSW	1	53933171	missense	probably damaging	1.00
R8769:Hecw2	UTSW	1	53913348	missense	probably benign	0.00
R8830:Hecw2	UTSW	1	53891146	missense	probably damaging	1.00
R8842:Hecw2	UTSW	1	53950874	missense
R8874:Hecw2	UTSW	1	53904449	splice site	probably benign
R9064:Hecw2	UTSW	1	53826886	missense	probably benign	0.08
R9326:Hecw2	UTSW	1	54040210	missense	probably damaging	1.00
R9450:Hecw2	UTSW	1	53839029	nonsense	probably null
R9486:Hecw2	UTSW	1	53813307	missense	probably damaging	1.00
R9763:Hecw2	UTSW	1	53923915	missense	probably damaging	1.00
R9766:Hecw2	UTSW	1	53865128	missense	probably damaging	1.00
Z1177:Hecw2	UTSW	1	53923943	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- ACACATTCTGCTCAGTGAGCCAG -3'
(R):5'- GCCACAGGTTTGCCCATGATTTTC -3'

Sequencing Primer
(F):5'- aaaaataaaaaaCAGAACTGGCCTTC -3'
(R):5'- AACTTCTGCTATTGCTGTTGAAGAG -3'

Posted On

2014-04-13