Incidental Mutation 'R1524:Fut7'
ID 167691
Institutional Source Beutler Lab
Gene Symbol Fut7
Ensembl Gene ENSMUSG00000036587
Gene Name fucosyltransferase 7
Synonyms FTVII, Fuc-TVII, FucT-VII
MMRRC Submission 039565-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R1524 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 25313279-25316386 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25315159 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 92 (V92A)
Ref Sequence ENSEMBL: ENSMUSP00000123526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041654] [ENSMUST00000100320] [ENSMUST00000102919] [ENSMUST00000114278] [ENSMUST00000134259]
AlphaFold Q11131
Predicted Effect probably damaging
Transcript: ENSMUST00000041654
AA Change: V92A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039985
Gene: ENSMUSG00000036587
AA Change: V92A

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 10 341 5.1e-122 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100320
AA Change: V139A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097895
Gene: ENSMUSG00000036587
AA Change: V139A

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
Pfam:Glyco_tran_10_N 91 201 8.8e-37 PFAM
Pfam:Glyco_transf_10 216 387 6.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102919
SMART Domains Protein: ENSMUSP00000099983
Gene: ENSMUSG00000026944

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
coiled coil region 271 296 N/A INTRINSIC
low complexity region 309 346 N/A INTRINSIC
Pfam:ABC2_membrane_3 493 911 9.7e-18 PFAM
AAA 1015 1197 9.22e-7 SMART
low complexity region 1364 1376 N/A INTRINSIC
low complexity region 1589 1607 N/A INTRINSIC
Pfam:ABC2_membrane_3 1696 2008 2.3e-44 PFAM
AAA 2079 2264 1.12e-5 SMART
low complexity region 2375 2394 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114278
AA Change: V92A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109917
Gene: ENSMUSG00000036587
AA Change: V92A

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 10 341 5.1e-122 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134259
AA Change: V92A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123526
Gene: ENSMUSG00000036587
AA Change: V92A

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 9 104 2.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142156
Meta Mutation Damage Score 0.6342 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of sialyl-Lewis X antigens. The encoded protein can direct the synthesis of the E-selectin-binding sialyl-Lewis X moiety. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are superficially normal. However, abnormalities are found in immune cell function and lymph node morphology. Redeuced tumor metastasis is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 88,119,548 (GRCm39) V102L probably benign Het
Adck1 T C 12: 88,368,854 (GRCm39) Y111H probably damaging Het
Adcy10 G T 1: 165,345,972 (GRCm39) K340N probably damaging Het
Aebp1 T C 11: 5,820,089 (GRCm39) V355A probably damaging Het
Atp2b2 T C 6: 113,751,162 (GRCm39) probably benign Het
Atrn T C 2: 130,799,000 (GRCm39) V390A probably benign Het
Bpifc T A 10: 85,813,599 (GRCm39) Q315L probably benign Het
C1qtnf6 T G 15: 78,409,092 (GRCm39) probably null Het
Cab39l A G 14: 59,757,186 (GRCm39) probably benign Het
Capn12 T A 7: 28,582,189 (GRCm39) probably benign Het
Ceacam18 A C 7: 43,288,779 (GRCm39) T177P possibly damaging Het
Ces5a A T 8: 94,252,293 (GRCm39) F200I probably damaging Het
Cldn19 G T 4: 119,114,248 (GRCm39) probably null Het
Cntnap2 A G 6: 46,507,613 (GRCm39) S46P probably damaging Het
Dchs1 A G 7: 105,413,732 (GRCm39) Y1028H probably damaging Het
Exd1 A T 2: 119,355,155 (GRCm39) F253L probably damaging Het
Fam161a A G 11: 22,965,826 (GRCm39) N40D possibly damaging Het
Fam81a A T 9: 70,032,390 (GRCm39) I34N probably damaging Het
Fchsd1 A C 18: 38,098,950 (GRCm39) probably null Het
Fut11 T A 14: 20,746,234 (GRCm39) F359I possibly damaging Het
Grid2 C G 6: 64,406,738 (GRCm39) F699L possibly damaging Het
Grin2a A G 16: 9,481,467 (GRCm39) S445P possibly damaging Het
H2al2b A C Y: 2,720,391 (GRCm39) F95C probably damaging Het
Hecw2 T C 1: 53,890,777 (GRCm39) D1246G probably damaging Het
Ifit1 A G 19: 34,625,032 (GRCm39) N56S probably damaging Het
Ldb3 C A 14: 34,277,313 (GRCm39) V354L probably benign Het
Lrig2 T C 3: 104,371,192 (GRCm39) Y479C probably benign Het
Ltn1 A G 16: 87,178,444 (GRCm39) V1595A probably damaging Het
Macf1 A G 4: 123,326,323 (GRCm39) V2939A possibly damaging Het
Mapre3 T G 5: 31,019,261 (GRCm39) I35S probably damaging Het
Med16 A T 10: 79,734,150 (GRCm39) L588Q probably damaging Het
Ncapg2 T C 12: 116,398,198 (GRCm39) probably benign Het
Ncstn C A 1: 171,899,716 (GRCm39) R322L possibly damaging Het
Ndst1 A T 18: 60,831,576 (GRCm39) I594N probably damaging Het
Ndst3 A G 3: 123,342,555 (GRCm39) I752T possibly damaging Het
Obscn G T 11: 59,006,681 (GRCm39) S1185R probably damaging Het
Or5b112 T A 19: 13,319,486 (GRCm39) C121* probably null Het
Or6aa1 A G 7: 86,044,020 (GRCm39) S229P probably benign Het
Or9q1 A T 19: 13,805,679 (GRCm39) L27H probably damaging Het
Otof T A 5: 30,536,900 (GRCm39) D1285V probably benign Het
Pcnx2 A G 8: 126,617,880 (GRCm39) I125T probably benign Het
Pde4a T C 9: 21,112,543 (GRCm39) S240P probably damaging Het
Pi15 T C 1: 17,690,076 (GRCm39) S126P probably benign Het
Pkhd1 T C 1: 20,188,004 (GRCm39) S3435G probably damaging Het
Plin1 C A 7: 79,376,338 (GRCm39) V133L probably benign Het
Pnpt1 T A 11: 29,080,776 (GRCm39) C7S unknown Het
Ppp3ca A T 3: 136,503,579 (GRCm39) M51L probably benign Het
Primpol G T 8: 47,039,502 (GRCm39) probably benign Het
Prlr T C 15: 10,319,419 (GRCm39) V116A probably damaging Het
Ptgr3 A G 18: 84,112,831 (GRCm39) E169G probably benign Het
Rnf139 A G 15: 58,761,266 (GRCm39) D35G probably damaging Het
Rsbn1l T A 5: 21,156,671 (GRCm39) K38M probably damaging Het
Ryr3 T A 2: 112,699,427 (GRCm39) I888F probably damaging Het
Sec16a C A 2: 26,318,394 (GRCm39) V1566F probably damaging Het
Sin3b A G 8: 73,479,915 (GRCm39) T874A probably benign Het
Skic3 T A 13: 76,286,491 (GRCm39) D891E probably benign Het
Slc5a5 A C 8: 71,344,978 (GRCm39) Y110D probably damaging Het
Smarcd2 C T 11: 106,157,978 (GRCm39) V97I probably benign Het
St6galnac2 G A 11: 116,575,313 (GRCm39) probably benign Het
Tbc1d22b T C 17: 29,789,585 (GRCm39) L149P probably damaging Het
Tekt2 T C 4: 126,217,442 (GRCm39) I208V probably benign Het
Tenm3 A G 8: 48,682,016 (GRCm39) I2522T possibly damaging Het
Ttll5 T A 12: 85,911,342 (GRCm39) Y233* probably null Het
Vcpip1 C T 1: 9,794,727 (GRCm39) E1215K probably damaging Het
Wdr4 T C 17: 31,728,737 (GRCm39) probably benign Het
Zfp703 G A 8: 27,469,401 (GRCm39) G355D probably damaging Het
Zfp830 T A 11: 82,655,794 (GRCm39) D199E probably damaging Het
Other mutations in Fut7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Fut7 APN 2 25,315,343 (GRCm39) nonsense probably null
IGL02483:Fut7 APN 2 25,313,888 (GRCm39) missense possibly damaging 0.47
IGL02967:Fut7 APN 2 25,315,155 (GRCm39) missense probably damaging 1.00
IGL03180:Fut7 APN 2 25,315,465 (GRCm39) missense possibly damaging 0.79
R1968:Fut7 UTSW 2 25,315,738 (GRCm39) missense probably benign 0.16
R2115:Fut7 UTSW 2 25,315,343 (GRCm39) nonsense probably null
R2900:Fut7 UTSW 2 25,313,923 (GRCm39) missense probably benign
R4448:Fut7 UTSW 2 25,314,951 (GRCm39) missense probably benign 0.06
R7019:Fut7 UTSW 2 25,315,792 (GRCm39) missense probably benign 0.00
R9222:Fut7 UTSW 2 25,315,191 (GRCm39) missense possibly damaging 0.81
R9349:Fut7 UTSW 2 25,314,993 (GRCm39) missense possibly damaging 0.73
R9648:Fut7 UTSW 2 25,315,336 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACAATTCCAGAAGGCTCCAG -3'
(R):5'- AGCTCAGCACCCAGTTGAAGATG -3'

Sequencing Primer
(F):5'- TTCCAGAAGGCTCCAGATGAATTG -3'
(R):5'- TTGAAGATGCCCCGGAAGC -3'
Posted On 2014-04-13