Mutagenetix > Incidental Mutation

Incidental Mutation 'R1524:Lrig2'

167696

Institutional Source

Beutler Lab

Gene Symbol

Lrig2

Ensembl Gene

ENSMUSG00000032913

Gene Name

leucine-rich repeats and immunoglobulin-like domains 2

Synonyms

4632419I10Rik

MMRRC Submission

039565-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1524 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104396418-104511918 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104463876 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 479 (Y479C)

Ref Sequence

ENSEMBL: ENSMUSP00000142373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046316] [ENSMUST00000198332] [ENSMUST00000199070]

AlphaFold

Q52KR2

Predicted Effect

probably benign
Transcript: ENSMUST00000046316
AA Change: Y837C

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000035999
Gene: ENSMUSG00000032913
AA Change: Y837C

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
low complexity region	68	82	N/A	INTRINSIC
LRR	118	141	3.56e2	SMART
LRR	142	165	1.81e2	SMART
LRR	167	188	1.31e0	SMART
LRR	213	236	1.41e0	SMART
LRR	237	260	4.98e-1	SMART
LRR	261	284	1.49e1	SMART
LRR	285	308	1.62e0	SMART
LRR	309	332	2.14e0	SMART
LRR_TYP	333	356	2.2e-2	SMART
LRR	357	383	9.22e0	SMART
LRR	384	407	2.17e-1	SMART
LRR_TYP	408	431	3.95e-4	SMART
LRRCT	442	492	3.62e-8	SMART
IG	503	598	2.19e-9	SMART
IGc2	613	681	1.94e-10	SMART
IGc2	707	772	3.2e-11	SMART
transmembrane domain	805	827	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196518

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197018

Predicted Effect

probably benign
Transcript: ENSMUST00000198332
AA Change: Y837C

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000142540
Gene: ENSMUSG00000032913
AA Change: Y837C

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
low complexity region	68	82	N/A	INTRINSIC
LRR	118	141	3.56e2	SMART
LRR	142	165	1.81e2	SMART
LRR	167	188	1.31e0	SMART
LRR	213	236	1.41e0	SMART
LRR	237	260	4.98e-1	SMART
LRR	261	284	1.49e1	SMART
LRR	285	308	1.62e0	SMART
LRR	309	332	2.14e0	SMART
LRR_TYP	333	356	2.2e-2	SMART
LRR	357	383	9.22e0	SMART
LRR	384	407	2.17e-1	SMART
LRR_TYP	408	431	3.95e-4	SMART
LRRCT	442	492	3.62e-8	SMART
IG	503	598	2.19e-9	SMART
IGc2	613	681	1.94e-10	SMART
IGc2	707	772	3.2e-11	SMART
transmembrane domain	805	827	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000199070
AA Change: Y479C

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000142373
Gene: ENSMUSG00000032913
AA Change: Y479C

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
LRRCT	84	134	1.8e-10	SMART
IG	145	240	9.2e-12	SMART
IGc2	255	323	8.1e-13	SMART
IGc2	349	414	1.3e-13	SMART
transmembrane domain	447	469	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000199180

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200453

Meta Mutation Damage Score

0.0694

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing leucine-rich repeats and immunoglobulin-like domains. The encoded protein promotes epidermal growth factor signalling, resulting in increased proliferation. Its expression in the cytoplasm of glioma cells is correlated with poor survival. Mutations in this gene can cause urofacial syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to PDGFB-induced glioma and premature death due to illness with reduced body weight, letahrgy, hackled fur, crouched posture and increased inflammatory response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	G	T	5: 87,971,689	V102L	probably benign	Het
Adck1	T	C	12: 88,402,084	Y111H	probably damaging	Het
Adcy10	G	T	1: 165,518,403	K340N	probably damaging	Het
Aebp1	T	C	11: 5,870,089	V355A	probably damaging	Het
Atp2b2	T	C	6: 113,774,201		probably benign	Het
Atrn	T	C	2: 130,957,080	V390A	probably benign	Het
Bpifc	T	A	10: 85,977,735	Q315L	probably benign	Het
C1qtnf6	T	G	15: 78,524,892		probably null	Het
Cab39l	A	G	14: 59,519,737		probably benign	Het
Capn12	T	A	7: 28,882,764		probably benign	Het
Ceacam18	A	C	7: 43,639,355	T177P	possibly damaging	Het
Ces5a	A	T	8: 93,525,665	F200I	probably damaging	Het
Cldn19	G	T	4: 119,257,051		probably null	Het
Cntnap2	A	G	6: 46,530,679	S46P	probably damaging	Het
Dchs1	A	G	7: 105,764,525	Y1028H	probably damaging	Het
Exd1	A	T	2: 119,524,674	F253L	probably damaging	Het
Fam161a	A	G	11: 23,015,826	N40D	possibly damaging	Het
Fam81a	A	T	9: 70,125,108	I34N	probably damaging	Het
Fchsd1	A	C	18: 37,965,897		probably null	Het
Fut11	T	A	14: 20,696,166	F359I	possibly damaging	Het
Fut7	T	C	2: 25,425,147	V92A	probably damaging	Het
Grid2	C	G	6: 64,429,754	F699L	possibly damaging	Het
Grin2a	A	G	16: 9,663,603	S445P	possibly damaging	Het
H2al2b	A	C	Y: 2,720,391	F95C	probably damaging	Het
Hecw2	T	C	1: 53,851,618	D1246G	probably damaging	Het
Ifit1	A	G	19: 34,647,632	N56S	probably damaging	Het
Ldb3	C	A	14: 34,555,356	V354L	probably benign	Het
Ltn1	A	G	16: 87,381,556	V1595A	probably damaging	Het
Macf1	A	G	4: 123,432,530	V2939A	possibly damaging	Het
Mapre3	T	G	5: 30,861,917	I35S	probably damaging	Het
Med16	A	T	10: 79,898,316	L588Q	probably damaging	Het
Ncapg2	T	C	12: 116,434,578		probably benign	Het
Ncstn	C	A	1: 172,072,149	R322L	possibly damaging	Het
Ndst1	A	T	18: 60,698,504	I594N	probably damaging	Het
Ndst3	A	G	3: 123,548,906	I752T	possibly damaging	Het
Obscn	G	T	11: 59,115,855	S1185R	probably damaging	Het
Olfr1466	T	A	19: 13,342,122	C121*	probably null	Het
Olfr1500	A	T	19: 13,828,315	L27H	probably damaging	Het
Olfr303	A	G	7: 86,394,812	S229P	probably benign	Het
Otof	T	A	5: 30,379,556	D1285V	probably benign	Het
Pcnx2	A	G	8: 125,891,141	I125T	probably benign	Het
Pde4a	T	C	9: 21,201,247	S240P	probably damaging	Het
Pi15	T	C	1: 17,619,852	S126P	probably benign	Het
Pkhd1	T	C	1: 20,117,780	S3435G	probably damaging	Het
Plin1	C	A	7: 79,726,590	V133L	probably benign	Het
Pnpt1	T	A	11: 29,130,776	C7S	unknown	Het
Ppp3ca	A	T	3: 136,797,818	M51L	probably benign	Het
Primpol	G	T	8: 46,586,467		probably benign	Het
Prlr	T	C	15: 10,319,333	V116A	probably damaging	Het
Rnf139	A	G	15: 58,889,417	D35G	probably damaging	Het
Rsbn1l	T	A	5: 20,951,673	K38M	probably damaging	Het
Ryr3	T	A	2: 112,869,082	I888F	probably damaging	Het
Sec16a	C	A	2: 26,428,382	V1566F	probably damaging	Het
Sin3b	A	G	8: 72,753,287	T874A	probably benign	Het
Slc5a5	A	C	8: 70,892,334	Y110D	probably damaging	Het
Smarcd2	C	T	11: 106,267,152	V97I	probably benign	Het
St6galnac2	G	A	11: 116,684,487		probably benign	Het
Tbc1d22b	T	C	17: 29,570,611	L149P	probably damaging	Het
Tekt2	T	C	4: 126,323,649	I208V	probably benign	Het
Tenm3	A	G	8: 48,228,981	I2522T	possibly damaging	Het
Ttc37	T	A	13: 76,138,372	D891E	probably benign	Het
Ttll5	T	A	12: 85,864,568	Y233*	probably null	Het
Vcpip1	C	T	1: 9,724,502	E1215K	probably damaging	Het
Wdr4	T	C	17: 31,509,763		probably benign	Het
Zadh2	A	G	18: 84,094,706	E169G	probably benign	Het
Zfp703	G	A	8: 26,979,373	G355D	probably damaging	Het
Zfp830	T	A	11: 82,764,968	D199E	probably damaging	Het

Other mutations in Lrig2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00657:Lrig2	APN	3	104467171	missense	probably damaging	0.99
IGL00715:Lrig2	APN	3	104463948	missense	probably damaging	1.00
IGL01105:Lrig2	APN	3	104464168	nonsense	probably null
IGL01767:Lrig2	APN	3	104491545	missense	probably benign	0.12
IGL02080:Lrig2	APN	3	104464124	missense	probably damaging	1.00
IGL02088:Lrig2	APN	3	104467108	missense	probably damaging	1.00
IGL02967:Lrig2	APN	3	104494196	intron	probably benign
IGL03024:Lrig2	APN	3	104494073	missense	probably damaging	1.00
IGL03079:Lrig2	APN	3	104490971	missense	probably damaging	0.98
IGL03085:Lrig2	APN	3	104467259	missense	probably damaging	1.00
IGL03162:Lrig2	APN	3	104464297	missense	probably damaging	1.00
Belladonna	UTSW	3	104467366	splice site	probably benign
R0414:Lrig2	UTSW	3	104494056	critical splice donor site	probably null
R0866:Lrig2	UTSW	3	104464275	missense	probably benign	0.00
R1184:Lrig2	UTSW	3	104490911	missense	possibly damaging	0.94
R1606:Lrig2	UTSW	3	104480107	critical splice donor site	probably null
R1672:Lrig2	UTSW	3	104491812	missense	probably damaging	1.00
R1701:Lrig2	UTSW	3	104494677	missense	probably benign	0.02
R1778:Lrig2	UTSW	3	104467366	splice site	probably benign
R2034:Lrig2	UTSW	3	104494092	missense	probably benign
R2100:Lrig2	UTSW	3	104511630	missense	possibly damaging	0.76
R2186:Lrig2	UTSW	3	104468598	missense	probably benign	0.00
R3778:Lrig2	UTSW	3	104457961	missense	probably benign
R3977:Lrig2	UTSW	3	104457844	missense	probably damaging	1.00
R4119:Lrig2	UTSW	3	104467195	missense	probably benign	0.00
R4210:Lrig2	UTSW	3	104467304	missense	probably benign	0.00
R4612:Lrig2	UTSW	3	104462783	missense	probably damaging	1.00
R4872:Lrig2	UTSW	3	104491526	missense	possibly damaging	0.66
R5020:Lrig2	UTSW	3	104457901	missense	possibly damaging	0.71
R5499:Lrig2	UTSW	3	104461557	missense	probably benign	0.00
R5687:Lrig2	UTSW	3	104464072	splice site	probably null
R5718:Lrig2	UTSW	3	104468615	nonsense	probably null
R5886:Lrig2	UTSW	3	104462698	missense	probably benign	0.01
R5921:Lrig2	UTSW	3	104462754	nonsense	probably null
R6434:Lrig2	UTSW	3	104491547	missense	possibly damaging	0.91
R6468:Lrig2	UTSW	3	104467193	missense	probably damaging	1.00
R6513:Lrig2	UTSW	3	104465729	missense	probably damaging	1.00
R6675:Lrig2	UTSW	3	104457935	missense	probably benign	0.35
R7243:Lrig2	UTSW	3	104497567	splice site	probably null
R7395:Lrig2	UTSW	3	104497520	missense	probably benign	0.00
R7444:Lrig2	UTSW	3	104497513	nonsense	probably null
R7514:Lrig2	UTSW	3	104465760	missense	probably damaging	1.00
R7751:Lrig2	UTSW	3	104494669	nonsense	probably null
R8720:Lrig2	UTSW	3	104511682	missense	probably damaging	0.99
R8809:Lrig2	UTSW	3	104461677	missense	probably benign	0.00
R9019:Lrig2	UTSW	3	104461598	missense	probably benign	0.27
R9204:Lrig2	UTSW	3	104480122	missense	possibly damaging	0.81
R9215:Lrig2	UTSW	3	104491008	missense	probably benign	0.00
R9549:Lrig2	UTSW	3	104490875	missense	probably damaging	0.97
R9562:Lrig2	UTSW	3	104468608	missense	possibly damaging	0.69
R9664:Lrig2	UTSW	3	104464240	missense	probably damaging	1.00
R9773:Lrig2	UTSW	3	104461522	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- TCGAGACAGCACTACTGAGATCCTTT -3'
(R):5'- TGGGACAGAACGGGGACATATTTACTT -3'

Sequencing Primer
(F):5'- gggcataacggcacacac -3'
(R):5'- TTACTTAAATGTCATTTCATCCCCC -3'

Posted On

2014-04-13