Incidental Mutation 'R1524:Lrig2'
ID 167696
Institutional Source Beutler Lab
Gene Symbol Lrig2
Ensembl Gene ENSMUSG00000032913
Gene Name leucine-rich repeats and immunoglobulin-like domains 2
Synonyms 4632419I10Rik
MMRRC Submission 039565-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1524 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 104361296-104419251 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104371192 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 479 (Y479C)
Ref Sequence ENSEMBL: ENSMUSP00000142373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046316] [ENSMUST00000198332] [ENSMUST00000199070]
AlphaFold Q52KR2
Predicted Effect probably benign
Transcript: ENSMUST00000046316
AA Change: Y837C

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000035999
Gene: ENSMUSG00000032913
AA Change: Y837C

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
LRR 118 141 3.56e2 SMART
LRR 142 165 1.81e2 SMART
LRR 167 188 1.31e0 SMART
LRR 213 236 1.41e0 SMART
LRR 237 260 4.98e-1 SMART
LRR 261 284 1.49e1 SMART
LRR 285 308 1.62e0 SMART
LRR 309 332 2.14e0 SMART
LRR_TYP 333 356 2.2e-2 SMART
LRR 357 383 9.22e0 SMART
LRR 384 407 2.17e-1 SMART
LRR_TYP 408 431 3.95e-4 SMART
LRRCT 442 492 3.62e-8 SMART
IG 503 598 2.19e-9 SMART
IGc2 613 681 1.94e-10 SMART
IGc2 707 772 3.2e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197018
Predicted Effect probably benign
Transcript: ENSMUST00000198332
AA Change: Y837C

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000142540
Gene: ENSMUSG00000032913
AA Change: Y837C

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
LRR 118 141 3.56e2 SMART
LRR 142 165 1.81e2 SMART
LRR 167 188 1.31e0 SMART
LRR 213 236 1.41e0 SMART
LRR 237 260 4.98e-1 SMART
LRR 261 284 1.49e1 SMART
LRR 285 308 1.62e0 SMART
LRR 309 332 2.14e0 SMART
LRR_TYP 333 356 2.2e-2 SMART
LRR 357 383 9.22e0 SMART
LRR 384 407 2.17e-1 SMART
LRR_TYP 408 431 3.95e-4 SMART
LRRCT 442 492 3.62e-8 SMART
IG 503 598 2.19e-9 SMART
IGc2 613 681 1.94e-10 SMART
IGc2 707 772 3.2e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199070
AA Change: Y479C

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142373
Gene: ENSMUSG00000032913
AA Change: Y479C

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
LRRCT 84 134 1.8e-10 SMART
IG 145 240 9.2e-12 SMART
IGc2 255 323 8.1e-13 SMART
IGc2 349 414 1.3e-13 SMART
transmembrane domain 447 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200453
Meta Mutation Damage Score 0.0694 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing leucine-rich repeats and immunoglobulin-like domains. The encoded protein promotes epidermal growth factor signalling, resulting in increased proliferation. Its expression in the cytoplasm of glioma cells is correlated with poor survival. Mutations in this gene can cause urofacial syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to PDGFB-induced glioma and premature death due to illness with reduced body weight, letahrgy, hackled fur, crouched posture and increased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 88,119,548 (GRCm39) V102L probably benign Het
Adck1 T C 12: 88,368,854 (GRCm39) Y111H probably damaging Het
Adcy10 G T 1: 165,345,972 (GRCm39) K340N probably damaging Het
Aebp1 T C 11: 5,820,089 (GRCm39) V355A probably damaging Het
Atp2b2 T C 6: 113,751,162 (GRCm39) probably benign Het
Atrn T C 2: 130,799,000 (GRCm39) V390A probably benign Het
Bpifc T A 10: 85,813,599 (GRCm39) Q315L probably benign Het
C1qtnf6 T G 15: 78,409,092 (GRCm39) probably null Het
Cab39l A G 14: 59,757,186 (GRCm39) probably benign Het
Capn12 T A 7: 28,582,189 (GRCm39) probably benign Het
Ceacam18 A C 7: 43,288,779 (GRCm39) T177P possibly damaging Het
Ces5a A T 8: 94,252,293 (GRCm39) F200I probably damaging Het
Cldn19 G T 4: 119,114,248 (GRCm39) probably null Het
Cntnap2 A G 6: 46,507,613 (GRCm39) S46P probably damaging Het
Dchs1 A G 7: 105,413,732 (GRCm39) Y1028H probably damaging Het
Exd1 A T 2: 119,355,155 (GRCm39) F253L probably damaging Het
Fam161a A G 11: 22,965,826 (GRCm39) N40D possibly damaging Het
Fam81a A T 9: 70,032,390 (GRCm39) I34N probably damaging Het
Fchsd1 A C 18: 38,098,950 (GRCm39) probably null Het
Fut11 T A 14: 20,746,234 (GRCm39) F359I possibly damaging Het
Fut7 T C 2: 25,315,159 (GRCm39) V92A probably damaging Het
Grid2 C G 6: 64,406,738 (GRCm39) F699L possibly damaging Het
Grin2a A G 16: 9,481,467 (GRCm39) S445P possibly damaging Het
H2al2b A C Y: 2,720,391 (GRCm39) F95C probably damaging Het
Hecw2 T C 1: 53,890,777 (GRCm39) D1246G probably damaging Het
Ifit1 A G 19: 34,625,032 (GRCm39) N56S probably damaging Het
Ldb3 C A 14: 34,277,313 (GRCm39) V354L probably benign Het
Ltn1 A G 16: 87,178,444 (GRCm39) V1595A probably damaging Het
Macf1 A G 4: 123,326,323 (GRCm39) V2939A possibly damaging Het
Mapre3 T G 5: 31,019,261 (GRCm39) I35S probably damaging Het
Med16 A T 10: 79,734,150 (GRCm39) L588Q probably damaging Het
Ncapg2 T C 12: 116,398,198 (GRCm39) probably benign Het
Ncstn C A 1: 171,899,716 (GRCm39) R322L possibly damaging Het
Ndst1 A T 18: 60,831,576 (GRCm39) I594N probably damaging Het
Ndst3 A G 3: 123,342,555 (GRCm39) I752T possibly damaging Het
Obscn G T 11: 59,006,681 (GRCm39) S1185R probably damaging Het
Or5b112 T A 19: 13,319,486 (GRCm39) C121* probably null Het
Or6aa1 A G 7: 86,044,020 (GRCm39) S229P probably benign Het
Or9q1 A T 19: 13,805,679 (GRCm39) L27H probably damaging Het
Otof T A 5: 30,536,900 (GRCm39) D1285V probably benign Het
Pcnx2 A G 8: 126,617,880 (GRCm39) I125T probably benign Het
Pde4a T C 9: 21,112,543 (GRCm39) S240P probably damaging Het
Pi15 T C 1: 17,690,076 (GRCm39) S126P probably benign Het
Pkhd1 T C 1: 20,188,004 (GRCm39) S3435G probably damaging Het
Plin1 C A 7: 79,376,338 (GRCm39) V133L probably benign Het
Pnpt1 T A 11: 29,080,776 (GRCm39) C7S unknown Het
Ppp3ca A T 3: 136,503,579 (GRCm39) M51L probably benign Het
Primpol G T 8: 47,039,502 (GRCm39) probably benign Het
Prlr T C 15: 10,319,419 (GRCm39) V116A probably damaging Het
Ptgr3 A G 18: 84,112,831 (GRCm39) E169G probably benign Het
Rnf139 A G 15: 58,761,266 (GRCm39) D35G probably damaging Het
Rsbn1l T A 5: 21,156,671 (GRCm39) K38M probably damaging Het
Ryr3 T A 2: 112,699,427 (GRCm39) I888F probably damaging Het
Sec16a C A 2: 26,318,394 (GRCm39) V1566F probably damaging Het
Sin3b A G 8: 73,479,915 (GRCm39) T874A probably benign Het
Skic3 T A 13: 76,286,491 (GRCm39) D891E probably benign Het
Slc5a5 A C 8: 71,344,978 (GRCm39) Y110D probably damaging Het
Smarcd2 C T 11: 106,157,978 (GRCm39) V97I probably benign Het
St6galnac2 G A 11: 116,575,313 (GRCm39) probably benign Het
Tbc1d22b T C 17: 29,789,585 (GRCm39) L149P probably damaging Het
Tekt2 T C 4: 126,217,442 (GRCm39) I208V probably benign Het
Tenm3 A G 8: 48,682,016 (GRCm39) I2522T possibly damaging Het
Ttll5 T A 12: 85,911,342 (GRCm39) Y233* probably null Het
Vcpip1 C T 1: 9,794,727 (GRCm39) E1215K probably damaging Het
Wdr4 T C 17: 31,728,737 (GRCm39) probably benign Het
Zfp703 G A 8: 27,469,401 (GRCm39) G355D probably damaging Het
Zfp830 T A 11: 82,655,794 (GRCm39) D199E probably damaging Het
Other mutations in Lrig2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Lrig2 APN 3 104,374,487 (GRCm39) missense probably damaging 0.99
IGL00715:Lrig2 APN 3 104,371,264 (GRCm39) missense probably damaging 1.00
IGL01105:Lrig2 APN 3 104,371,484 (GRCm39) nonsense probably null
IGL01767:Lrig2 APN 3 104,398,861 (GRCm39) missense probably benign 0.12
IGL02080:Lrig2 APN 3 104,371,440 (GRCm39) missense probably damaging 1.00
IGL02088:Lrig2 APN 3 104,374,424 (GRCm39) missense probably damaging 1.00
IGL02967:Lrig2 APN 3 104,401,512 (GRCm39) intron probably benign
IGL03024:Lrig2 APN 3 104,401,389 (GRCm39) missense probably damaging 1.00
IGL03079:Lrig2 APN 3 104,398,287 (GRCm39) missense probably damaging 0.98
IGL03085:Lrig2 APN 3 104,374,575 (GRCm39) missense probably damaging 1.00
IGL03162:Lrig2 APN 3 104,371,613 (GRCm39) missense probably damaging 1.00
Belladonna UTSW 3 104,374,682 (GRCm39) splice site probably benign
R0414:Lrig2 UTSW 3 104,401,372 (GRCm39) critical splice donor site probably null
R0866:Lrig2 UTSW 3 104,371,591 (GRCm39) missense probably benign 0.00
R1184:Lrig2 UTSW 3 104,398,227 (GRCm39) missense possibly damaging 0.94
R1606:Lrig2 UTSW 3 104,387,423 (GRCm39) critical splice donor site probably null
R1672:Lrig2 UTSW 3 104,399,128 (GRCm39) missense probably damaging 1.00
R1701:Lrig2 UTSW 3 104,401,993 (GRCm39) missense probably benign 0.02
R1778:Lrig2 UTSW 3 104,374,682 (GRCm39) splice site probably benign
R2034:Lrig2 UTSW 3 104,401,408 (GRCm39) missense probably benign
R2100:Lrig2 UTSW 3 104,418,946 (GRCm39) missense possibly damaging 0.76
R2186:Lrig2 UTSW 3 104,375,914 (GRCm39) missense probably benign 0.00
R3778:Lrig2 UTSW 3 104,365,277 (GRCm39) missense probably benign
R3977:Lrig2 UTSW 3 104,365,160 (GRCm39) missense probably damaging 1.00
R4119:Lrig2 UTSW 3 104,374,511 (GRCm39) missense probably benign 0.00
R4210:Lrig2 UTSW 3 104,374,620 (GRCm39) missense probably benign 0.00
R4612:Lrig2 UTSW 3 104,370,099 (GRCm39) missense probably damaging 1.00
R4872:Lrig2 UTSW 3 104,398,842 (GRCm39) missense possibly damaging 0.66
R5020:Lrig2 UTSW 3 104,365,217 (GRCm39) missense possibly damaging 0.71
R5499:Lrig2 UTSW 3 104,368,873 (GRCm39) missense probably benign 0.00
R5687:Lrig2 UTSW 3 104,371,388 (GRCm39) splice site probably null
R5718:Lrig2 UTSW 3 104,375,931 (GRCm39) nonsense probably null
R5886:Lrig2 UTSW 3 104,370,014 (GRCm39) missense probably benign 0.01
R5921:Lrig2 UTSW 3 104,370,070 (GRCm39) nonsense probably null
R6434:Lrig2 UTSW 3 104,398,863 (GRCm39) missense possibly damaging 0.91
R6468:Lrig2 UTSW 3 104,374,509 (GRCm39) missense probably damaging 1.00
R6513:Lrig2 UTSW 3 104,373,045 (GRCm39) missense probably damaging 1.00
R6675:Lrig2 UTSW 3 104,365,251 (GRCm39) missense probably benign 0.35
R7243:Lrig2 UTSW 3 104,404,883 (GRCm39) splice site probably null
R7395:Lrig2 UTSW 3 104,404,836 (GRCm39) missense probably benign 0.00
R7444:Lrig2 UTSW 3 104,404,829 (GRCm39) nonsense probably null
R7514:Lrig2 UTSW 3 104,373,076 (GRCm39) missense probably damaging 1.00
R7751:Lrig2 UTSW 3 104,401,985 (GRCm39) nonsense probably null
R8720:Lrig2 UTSW 3 104,418,998 (GRCm39) missense probably damaging 0.99
R8809:Lrig2 UTSW 3 104,368,993 (GRCm39) missense probably benign 0.00
R9019:Lrig2 UTSW 3 104,368,914 (GRCm39) missense probably benign 0.27
R9204:Lrig2 UTSW 3 104,387,438 (GRCm39) missense possibly damaging 0.81
R9215:Lrig2 UTSW 3 104,398,324 (GRCm39) missense probably benign 0.00
R9549:Lrig2 UTSW 3 104,398,191 (GRCm39) missense probably damaging 0.97
R9562:Lrig2 UTSW 3 104,375,924 (GRCm39) missense possibly damaging 0.69
R9664:Lrig2 UTSW 3 104,371,556 (GRCm39) missense probably damaging 1.00
R9773:Lrig2 UTSW 3 104,368,838 (GRCm39) missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TCGAGACAGCACTACTGAGATCCTTT -3'
(R):5'- TGGGACAGAACGGGGACATATTTACTT -3'

Sequencing Primer
(F):5'- gggcataacggcacacac -3'
(R):5'- TTACTTAAATGTCATTTCATCCCCC -3'
Posted On 2014-04-13