Incidental Mutation 'R1524:Ndst3'
ID 167697
Institutional Source Beutler Lab
Gene Symbol Ndst3
Ensembl Gene ENSMUSG00000027977
Gene Name N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms 4930511P15Rik, 4921531K01Rik
MMRRC Submission 039565-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.248) question?
Stock # R1524 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 123319815-123484502 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123342555 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 752 (I752T)
Ref Sequence ENSEMBL: ENSMUSP00000133657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029602] [ENSMUST00000124803] [ENSMUST00000132112] [ENSMUST00000137404] [ENSMUST00000154668] [ENSMUST00000172537]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000029602
AA Change: I752T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029602
Gene: ENSMUSG00000027977
AA Change: I752T

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 4.6e-272 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124803
AA Change: I337T

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122617
Gene: ENSMUSG00000027977
AA Change: I337T

DomainStartEndE-ValueType
Pfam:HSNSD 1 91 1.7e-62 PFAM
Pfam:Sulfotransfer_1 180 443 7.8e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000132112
AA Change: I337T

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120623
Gene: ENSMUSG00000027977
AA Change: I337T

DomainStartEndE-ValueType
Pfam:HSNSD 1 91 1.7e-62 PFAM
Pfam:Sulfotransfer_1 180 443 7.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137404
SMART Domains Protein: ENSMUSP00000118796
Gene: ENSMUSG00000027977

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 6.4e-272 PFAM
PDB:1NST|A 549 637 2e-38 PDB
SCOP:d1nsta_ 570 641 9e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154668
AA Change: I752T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118207
Gene: ENSMUSG00000027977
AA Change: I752T

DomainStartEndE-ValueType
Pfam:HSNSD 20 506 1.7e-253 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172537
AA Change: I752T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133657
Gene: ENSMUSG00000027977
AA Change: I752T

DomainStartEndE-ValueType
Pfam:HSNSD 20 328 2.4e-130 PFAM
Pfam:HSNSD 326 425 8.2e-62 PFAM
PDB:1NST|A 468 556 7e-39 PDB
SCOP:d1nsta_ 489 560 5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199046
Meta Mutation Damage Score 0.5433 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate and heparin, which are the initial chemical modifications required for the biosynthesis of the functional oligosaccharide sequences that define the specific ligand binding activities of heparan sulfate and heparin. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased anxiety-related behavior, cholesterol levels and CD8+ T cells due to moderate heparan-sulfate undersulfation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 88,119,548 (GRCm39) V102L probably benign Het
Adck1 T C 12: 88,368,854 (GRCm39) Y111H probably damaging Het
Adcy10 G T 1: 165,345,972 (GRCm39) K340N probably damaging Het
Aebp1 T C 11: 5,820,089 (GRCm39) V355A probably damaging Het
Atp2b2 T C 6: 113,751,162 (GRCm39) probably benign Het
Atrn T C 2: 130,799,000 (GRCm39) V390A probably benign Het
Bpifc T A 10: 85,813,599 (GRCm39) Q315L probably benign Het
C1qtnf6 T G 15: 78,409,092 (GRCm39) probably null Het
Cab39l A G 14: 59,757,186 (GRCm39) probably benign Het
Capn12 T A 7: 28,582,189 (GRCm39) probably benign Het
Ceacam18 A C 7: 43,288,779 (GRCm39) T177P possibly damaging Het
Ces5a A T 8: 94,252,293 (GRCm39) F200I probably damaging Het
Cldn19 G T 4: 119,114,248 (GRCm39) probably null Het
Cntnap2 A G 6: 46,507,613 (GRCm39) S46P probably damaging Het
Dchs1 A G 7: 105,413,732 (GRCm39) Y1028H probably damaging Het
Exd1 A T 2: 119,355,155 (GRCm39) F253L probably damaging Het
Fam161a A G 11: 22,965,826 (GRCm39) N40D possibly damaging Het
Fam81a A T 9: 70,032,390 (GRCm39) I34N probably damaging Het
Fchsd1 A C 18: 38,098,950 (GRCm39) probably null Het
Fut11 T A 14: 20,746,234 (GRCm39) F359I possibly damaging Het
Fut7 T C 2: 25,315,159 (GRCm39) V92A probably damaging Het
Grid2 C G 6: 64,406,738 (GRCm39) F699L possibly damaging Het
Grin2a A G 16: 9,481,467 (GRCm39) S445P possibly damaging Het
H2al2b A C Y: 2,720,391 (GRCm39) F95C probably damaging Het
Hecw2 T C 1: 53,890,777 (GRCm39) D1246G probably damaging Het
Ifit1 A G 19: 34,625,032 (GRCm39) N56S probably damaging Het
Ldb3 C A 14: 34,277,313 (GRCm39) V354L probably benign Het
Lrig2 T C 3: 104,371,192 (GRCm39) Y479C probably benign Het
Ltn1 A G 16: 87,178,444 (GRCm39) V1595A probably damaging Het
Macf1 A G 4: 123,326,323 (GRCm39) V2939A possibly damaging Het
Mapre3 T G 5: 31,019,261 (GRCm39) I35S probably damaging Het
Med16 A T 10: 79,734,150 (GRCm39) L588Q probably damaging Het
Ncapg2 T C 12: 116,398,198 (GRCm39) probably benign Het
Ncstn C A 1: 171,899,716 (GRCm39) R322L possibly damaging Het
Ndst1 A T 18: 60,831,576 (GRCm39) I594N probably damaging Het
Obscn G T 11: 59,006,681 (GRCm39) S1185R probably damaging Het
Or5b112 T A 19: 13,319,486 (GRCm39) C121* probably null Het
Or6aa1 A G 7: 86,044,020 (GRCm39) S229P probably benign Het
Or9q1 A T 19: 13,805,679 (GRCm39) L27H probably damaging Het
Otof T A 5: 30,536,900 (GRCm39) D1285V probably benign Het
Pcnx2 A G 8: 126,617,880 (GRCm39) I125T probably benign Het
Pde4a T C 9: 21,112,543 (GRCm39) S240P probably damaging Het
Pi15 T C 1: 17,690,076 (GRCm39) S126P probably benign Het
Pkhd1 T C 1: 20,188,004 (GRCm39) S3435G probably damaging Het
Plin1 C A 7: 79,376,338 (GRCm39) V133L probably benign Het
Pnpt1 T A 11: 29,080,776 (GRCm39) C7S unknown Het
Ppp3ca A T 3: 136,503,579 (GRCm39) M51L probably benign Het
Primpol G T 8: 47,039,502 (GRCm39) probably benign Het
Prlr T C 15: 10,319,419 (GRCm39) V116A probably damaging Het
Ptgr3 A G 18: 84,112,831 (GRCm39) E169G probably benign Het
Rnf139 A G 15: 58,761,266 (GRCm39) D35G probably damaging Het
Rsbn1l T A 5: 21,156,671 (GRCm39) K38M probably damaging Het
Ryr3 T A 2: 112,699,427 (GRCm39) I888F probably damaging Het
Sec16a C A 2: 26,318,394 (GRCm39) V1566F probably damaging Het
Sin3b A G 8: 73,479,915 (GRCm39) T874A probably benign Het
Skic3 T A 13: 76,286,491 (GRCm39) D891E probably benign Het
Slc5a5 A C 8: 71,344,978 (GRCm39) Y110D probably damaging Het
Smarcd2 C T 11: 106,157,978 (GRCm39) V97I probably benign Het
St6galnac2 G A 11: 116,575,313 (GRCm39) probably benign Het
Tbc1d22b T C 17: 29,789,585 (GRCm39) L149P probably damaging Het
Tekt2 T C 4: 126,217,442 (GRCm39) I208V probably benign Het
Tenm3 A G 8: 48,682,016 (GRCm39) I2522T possibly damaging Het
Ttll5 T A 12: 85,911,342 (GRCm39) Y233* probably null Het
Vcpip1 C T 1: 9,794,727 (GRCm39) E1215K probably damaging Het
Wdr4 T C 17: 31,728,737 (GRCm39) probably benign Het
Zfp703 G A 8: 27,469,401 (GRCm39) G355D probably damaging Het
Zfp830 T A 11: 82,655,794 (GRCm39) D199E probably damaging Het
Other mutations in Ndst3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Ndst3 APN 3 123,421,599 (GRCm39) splice site probably benign
IGL00543:Ndst3 APN 3 123,465,912 (GRCm39) missense probably damaging 0.99
IGL01067:Ndst3 APN 3 123,340,466 (GRCm39) missense probably damaging 1.00
IGL01301:Ndst3 APN 3 123,342,565 (GRCm39) missense probably damaging 0.97
IGL01975:Ndst3 APN 3 123,395,163 (GRCm39) missense possibly damaging 0.67
IGL02376:Ndst3 APN 3 123,350,447 (GRCm39) missense probably damaging 0.98
IGL02715:Ndst3 APN 3 123,340,410 (GRCm39) splice site probably benign
IGL03111:Ndst3 APN 3 123,465,745 (GRCm39) missense possibly damaging 0.96
Jack_sprat UTSW 3 123,346,201 (GRCm39) missense probably damaging 0.99
ANU18:Ndst3 UTSW 3 123,342,565 (GRCm39) missense probably damaging 0.97
R0027:Ndst3 UTSW 3 123,465,162 (GRCm39) missense probably damaging 1.00
R0288:Ndst3 UTSW 3 123,465,843 (GRCm39) missense probably benign 0.03
R0630:Ndst3 UTSW 3 123,355,720 (GRCm39) missense probably damaging 0.98
R1168:Ndst3 UTSW 3 123,400,617 (GRCm39) missense probably benign 0.22
R1400:Ndst3 UTSW 3 123,350,477 (GRCm39) missense probably damaging 1.00
R1513:Ndst3 UTSW 3 123,395,104 (GRCm39) missense possibly damaging 0.75
R1830:Ndst3 UTSW 3 123,342,587 (GRCm39) missense probably damaging 0.96
R1831:Ndst3 UTSW 3 123,395,127 (GRCm39) missense probably benign
R1865:Ndst3 UTSW 3 123,465,120 (GRCm39) missense probably damaging 1.00
R1871:Ndst3 UTSW 3 123,355,673 (GRCm39) missense probably damaging 1.00
R2041:Ndst3 UTSW 3 123,465,864 (GRCm39) missense probably benign 0.01
R2056:Ndst3 UTSW 3 123,465,534 (GRCm39) missense probably damaging 0.98
R2362:Ndst3 UTSW 3 123,346,327 (GRCm39) missense possibly damaging 0.94
R2484:Ndst3 UTSW 3 123,346,186 (GRCm39) missense possibly damaging 0.83
R3747:Ndst3 UTSW 3 123,465,201 (GRCm39) missense probably benign 0.09
R4152:Ndst3 UTSW 3 123,465,876 (GRCm39) missense probably damaging 1.00
R4153:Ndst3 UTSW 3 123,465,876 (GRCm39) missense probably damaging 1.00
R4154:Ndst3 UTSW 3 123,465,876 (GRCm39) missense probably damaging 1.00
R4512:Ndst3 UTSW 3 123,465,315 (GRCm39) missense probably damaging 1.00
R4579:Ndst3 UTSW 3 123,340,474 (GRCm39) missense probably benign 0.00
R4611:Ndst3 UTSW 3 123,465,198 (GRCm39) missense probably benign 0.35
R4646:Ndst3 UTSW 3 123,465,684 (GRCm39) missense probably damaging 0.96
R4718:Ndst3 UTSW 3 123,465,915 (GRCm39) missense probably benign 0.35
R4944:Ndst3 UTSW 3 123,400,676 (GRCm39) missense probably damaging 0.99
R4945:Ndst3 UTSW 3 123,346,201 (GRCm39) missense probably damaging 1.00
R5179:Ndst3 UTSW 3 123,346,181 (GRCm39) missense probably damaging 0.97
R5232:Ndst3 UTSW 3 123,465,888 (GRCm39) missense probably damaging 0.99
R5421:Ndst3 UTSW 3 123,428,008 (GRCm39) splice site probably null
R5874:Ndst3 UTSW 3 123,355,556 (GRCm39) missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123,346,168 (GRCm39) missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123,346,168 (GRCm39) missense probably damaging 1.00
R6228:Ndst3 UTSW 3 123,465,301 (GRCm39) nonsense probably null
R6496:Ndst3 UTSW 3 123,346,201 (GRCm39) missense probably damaging 0.99
R6562:Ndst3 UTSW 3 123,346,181 (GRCm39) missense probably damaging 0.97
R7045:Ndst3 UTSW 3 123,465,732 (GRCm39) missense probably damaging 0.96
R7152:Ndst3 UTSW 3 123,346,305 (GRCm39) missense possibly damaging 0.66
R7202:Ndst3 UTSW 3 123,465,388 (GRCm39) missense possibly damaging 0.94
R7239:Ndst3 UTSW 3 123,400,555 (GRCm39) missense probably damaging 1.00
R7305:Ndst3 UTSW 3 123,395,131 (GRCm39) missense possibly damaging 0.62
R7417:Ndst3 UTSW 3 123,465,313 (GRCm39) missense probably damaging 1.00
R7469:Ndst3 UTSW 3 123,465,310 (GRCm39) missense possibly damaging 0.82
R7553:Ndst3 UTSW 3 123,350,709 (GRCm39) splice site probably null
R7955:Ndst3 UTSW 3 123,400,586 (GRCm39) missense probably benign 0.01
R8065:Ndst3 UTSW 3 123,395,094 (GRCm39) missense probably damaging 1.00
R8067:Ndst3 UTSW 3 123,395,094 (GRCm39) missense probably damaging 1.00
R8363:Ndst3 UTSW 3 123,350,517 (GRCm39) missense possibly damaging 0.83
R8708:Ndst3 UTSW 3 123,322,564 (GRCm39) missense probably benign 0.01
R8752:Ndst3 UTSW 3 123,342,684 (GRCm39) missense probably damaging 1.00
R9051:Ndst3 UTSW 3 123,465,549 (GRCm39) missense probably benign 0.00
R9428:Ndst3 UTSW 3 123,340,518 (GRCm39) missense probably benign 0.00
R9511:Ndst3 UTSW 3 123,400,555 (GRCm39) missense probably damaging 1.00
R9537:Ndst3 UTSW 3 123,465,162 (GRCm39) missense
R9662:Ndst3 UTSW 3 123,465,115 (GRCm39) missense probably benign 0.01
R9667:Ndst3 UTSW 3 123,353,866 (GRCm39) missense possibly damaging 0.67
R9747:Ndst3 UTSW 3 123,340,461 (GRCm39) missense possibly damaging 0.84
R9748:Ndst3 UTSW 3 123,421,631 (GRCm39) missense probably benign 0.17
Z1176:Ndst3 UTSW 3 123,465,143 (GRCm39) missense probably damaging 1.00
Z1176:Ndst3 UTSW 3 123,421,618 (GRCm39) missense possibly damaging 0.49
Z1176:Ndst3 UTSW 3 123,346,279 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCGAACCTTTTCAAACCTCACG -3'
(R):5'- TGGGCAAGCAAAGAAATACCACCTG -3'

Sequencing Primer
(F):5'- GGCATCCTAACGCCAATAAGTTG -3'
(R):5'- ACTTTGATGCTCTGAGCACAG -3'
Posted On 2014-04-13