Incidental Mutation 'R1524:Ppp3ca'
ID 167698
Institutional Source Beutler Lab
Gene Symbol Ppp3ca
Ensembl Gene ENSMUSG00000028161
Gene Name protein phosphatase 3, catalytic subunit, alpha isoform
Synonyms Caln, PP2BA alpha, 2900074D19Rik, PP2B alpha 1, Calna, CnA, CN
MMRRC Submission 039565-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1524 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 136670124-136937727 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 136797818 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 51 (M51L)
Ref Sequence ENSEMBL: ENSMUSP00000071040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056758] [ENSMUST00000070198]
AlphaFold P63328
Predicted Effect probably benign
Transcript: ENSMUST00000056758
AA Change: M51L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053101
Gene: ENSMUSG00000028161
AA Change: M51L

DomainStartEndE-ValueType
PP2Ac 56 347 2.91e-162 SMART
low complexity region 507 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070198
AA Change: M51L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071040
Gene: ENSMUSG00000028161
AA Change: M51L

DomainStartEndE-ValueType
PP2Ac 56 347 2.91e-162 SMART
low complexity region 497 509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200068
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased T cell proliferation and abnormal mossy fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 87,971,689 (GRCm38) V102L probably benign Het
Adck1 T C 12: 88,402,084 (GRCm38) Y111H probably damaging Het
Adcy10 G T 1: 165,518,403 (GRCm38) K340N probably damaging Het
Aebp1 T C 11: 5,870,089 (GRCm38) V355A probably damaging Het
Atp2b2 T C 6: 113,774,201 (GRCm38) probably benign Het
Atrn T C 2: 130,957,080 (GRCm38) V390A probably benign Het
Bpifc T A 10: 85,977,735 (GRCm38) Q315L probably benign Het
C1qtnf6 T G 15: 78,524,892 (GRCm38) probably null Het
Cab39l A G 14: 59,519,737 (GRCm38) probably benign Het
Capn12 T A 7: 28,882,764 (GRCm38) probably benign Het
Ceacam18 A C 7: 43,639,355 (GRCm38) T177P possibly damaging Het
Ces5a A T 8: 93,525,665 (GRCm38) F200I probably damaging Het
Cldn19 G T 4: 119,257,051 (GRCm38) probably null Het
Cntnap2 A G 6: 46,530,679 (GRCm38) S46P probably damaging Het
Dchs1 A G 7: 105,764,525 (GRCm38) Y1028H probably damaging Het
Exd1 A T 2: 119,524,674 (GRCm38) F253L probably damaging Het
Fam161a A G 11: 23,015,826 (GRCm38) N40D possibly damaging Het
Fam81a A T 9: 70,125,108 (GRCm38) I34N probably damaging Het
Fchsd1 A C 18: 37,965,897 (GRCm38) probably null Het
Fut11 T A 14: 20,696,166 (GRCm38) F359I possibly damaging Het
Fut7 T C 2: 25,425,147 (GRCm38) V92A probably damaging Het
Grid2 C G 6: 64,429,754 (GRCm38) F699L possibly damaging Het
Grin2a A G 16: 9,663,603 (GRCm38) S445P possibly damaging Het
H2al2b A C Y: 2,720,391 (GRCm38) F95C probably damaging Het
Hecw2 T C 1: 53,851,618 (GRCm38) D1246G probably damaging Het
Ifit1 A G 19: 34,647,632 (GRCm38) N56S probably damaging Het
Ldb3 C A 14: 34,555,356 (GRCm38) V354L probably benign Het
Lrig2 T C 3: 104,463,876 (GRCm38) Y479C probably benign Het
Ltn1 A G 16: 87,381,556 (GRCm38) V1595A probably damaging Het
Macf1 A G 4: 123,432,530 (GRCm38) V2939A possibly damaging Het
Mapre3 T G 5: 30,861,917 (GRCm38) I35S probably damaging Het
Med16 A T 10: 79,898,316 (GRCm38) L588Q probably damaging Het
Ncapg2 T C 12: 116,434,578 (GRCm38) probably benign Het
Ncstn C A 1: 172,072,149 (GRCm38) R322L possibly damaging Het
Ndst1 A T 18: 60,698,504 (GRCm38) I594N probably damaging Het
Ndst3 A G 3: 123,548,906 (GRCm38) I752T possibly damaging Het
Obscn G T 11: 59,115,855 (GRCm38) S1185R probably damaging Het
Olfr1466 T A 19: 13,342,122 (GRCm38) C121* probably null Het
Olfr1500 A T 19: 13,828,315 (GRCm38) L27H probably damaging Het
Olfr303 A G 7: 86,394,812 (GRCm38) S229P probably benign Het
Otof T A 5: 30,379,556 (GRCm38) D1285V probably benign Het
Pcnx2 A G 8: 125,891,141 (GRCm38) I125T probably benign Het
Pde4a T C 9: 21,201,247 (GRCm38) S240P probably damaging Het
Pi15 T C 1: 17,619,852 (GRCm38) S126P probably benign Het
Pkhd1 T C 1: 20,117,780 (GRCm38) S3435G probably damaging Het
Plin1 C A 7: 79,726,590 (GRCm38) V133L probably benign Het
Pnpt1 T A 11: 29,130,776 (GRCm38) C7S unknown Het
Primpol G T 8: 46,586,467 (GRCm38) probably benign Het
Prlr T C 15: 10,319,333 (GRCm38) V116A probably damaging Het
Rnf139 A G 15: 58,889,417 (GRCm38) D35G probably damaging Het
Rsbn1l T A 5: 20,951,673 (GRCm38) K38M probably damaging Het
Ryr3 T A 2: 112,869,082 (GRCm38) I888F probably damaging Het
Sec16a C A 2: 26,428,382 (GRCm38) V1566F probably damaging Het
Sin3b A G 8: 72,753,287 (GRCm38) T874A probably benign Het
Slc5a5 A C 8: 70,892,334 (GRCm38) Y110D probably damaging Het
Smarcd2 C T 11: 106,267,152 (GRCm38) V97I probably benign Het
St6galnac2 G A 11: 116,684,487 (GRCm38) probably benign Het
Tbc1d22b T C 17: 29,570,611 (GRCm38) L149P probably damaging Het
Tekt2 T C 4: 126,323,649 (GRCm38) I208V probably benign Het
Tenm3 A G 8: 48,228,981 (GRCm38) I2522T possibly damaging Het
Ttc37 T A 13: 76,138,372 (GRCm38) D891E probably benign Het
Ttll5 T A 12: 85,864,568 (GRCm38) Y233* probably null Het
Vcpip1 C T 1: 9,724,502 (GRCm38) E1215K probably damaging Het
Wdr4 T C 17: 31,509,763 (GRCm38) probably benign Het
Zadh2 A G 18: 84,094,706 (GRCm38) E169G probably benign Het
Zfp703 G A 8: 26,979,373 (GRCm38) G355D probably damaging Het
Zfp830 T A 11: 82,764,968 (GRCm38) D199E probably damaging Het
Other mutations in Ppp3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Ppp3ca APN 3 136,935,181 (GRCm38) missense probably benign 0.01
IGL01405:Ppp3ca APN 3 136,868,721 (GRCm38) missense probably benign 0.33
IGL02061:Ppp3ca APN 3 136,797,863 (GRCm38) missense probably benign
IGL02285:Ppp3ca APN 3 136,928,626 (GRCm38) splice site probably benign
IGL02472:Ppp3ca APN 3 136,921,862 (GRCm38) missense possibly damaging 0.57
IGL02706:Ppp3ca APN 3 136,905,318 (GRCm38) missense possibly damaging 0.84
IGL02894:Ppp3ca APN 3 136,797,812 (GRCm38) missense probably damaging 1.00
R0325:Ppp3ca UTSW 3 136,935,139 (GRCm38) missense probably benign 0.15
R1072:Ppp3ca UTSW 3 136,935,127 (GRCm38) missense probably benign
R1427:Ppp3ca UTSW 3 136,921,914 (GRCm38) missense probably damaging 1.00
R1568:Ppp3ca UTSW 3 136,928,544 (GRCm38) missense probably benign 0.00
R1754:Ppp3ca UTSW 3 136,881,448 (GRCm38) missense probably benign 0.20
R1800:Ppp3ca UTSW 3 136,935,031 (GRCm38) missense probably damaging 0.98
R1844:Ppp3ca UTSW 3 136,921,911 (GRCm38) missense probably benign 0.08
R1878:Ppp3ca UTSW 3 136,797,878 (GRCm38) missense probably benign 0.03
R2155:Ppp3ca UTSW 3 136,890,450 (GRCm38) missense possibly damaging 0.95
R2160:Ppp3ca UTSW 3 136,877,630 (GRCm38) missense probably damaging 1.00
R2220:Ppp3ca UTSW 3 136,797,924 (GRCm38) missense probably damaging 1.00
R2331:Ppp3ca UTSW 3 136,797,819 (GRCm38) missense probably benign
R3052:Ppp3ca UTSW 3 136,797,844 (GRCm38) missense probably benign 0.00
R3500:Ppp3ca UTSW 3 136,881,512 (GRCm38) missense probably benign 0.00
R4764:Ppp3ca UTSW 3 136,890,489 (GRCm38) missense probably damaging 0.99
R4974:Ppp3ca UTSW 3 136,935,049 (GRCm38) missense possibly damaging 0.60
R5952:Ppp3ca UTSW 3 136,928,571 (GRCm38) missense probably benign 0.08
R6051:Ppp3ca UTSW 3 136,876,122 (GRCm38) missense probably damaging 1.00
R6395:Ppp3ca UTSW 3 136,877,770 (GRCm38) missense possibly damaging 0.47
R6975:Ppp3ca UTSW 3 136,905,301 (GRCm38) missense probably damaging 1.00
R7121:Ppp3ca UTSW 3 136,868,626 (GRCm38) missense probably damaging 1.00
R7720:Ppp3ca UTSW 3 136,890,489 (GRCm38) missense probably damaging 1.00
R7773:Ppp3ca UTSW 3 136,890,461 (GRCm38) missense probably benign
R7828:Ppp3ca UTSW 3 136,797,774 (GRCm38) missense probably damaging 1.00
R7830:Ppp3ca UTSW 3 136,868,720 (GRCm38) missense probably damaging 1.00
R8108:Ppp3ca UTSW 3 136,932,225 (GRCm38) splice site probably null
R8126:Ppp3ca UTSW 3 136,903,191 (GRCm38) missense probably damaging 0.99
R8285:Ppp3ca UTSW 3 136,881,444 (GRCm38) missense probably damaging 1.00
R8516:Ppp3ca UTSW 3 136,877,768 (GRCm38) missense probably damaging 1.00
R8537:Ppp3ca UTSW 3 136,797,858 (GRCm38) missense possibly damaging 0.89
R9662:Ppp3ca UTSW 3 136,877,740 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGACTGAGAAGACCCATAAGCC -3'
(R):5'- TGAGGACACCACAAGGAATCTTGC -3'

Sequencing Primer
(F):5'- AACTCTTGGTAGACTCTGAATGTG -3'
(R):5'- GGCTTTCTGCTGATAGAACAC -3'
Posted On 2014-04-13