Incidental Mutation 'R1524:Tekt2'
ID 167701
Institutional Source Beutler Lab
Gene Symbol Tekt2
Ensembl Gene ENSMUSG00000028845
Gene Name tektin 2
Synonyms tektin-t
MMRRC Submission 039565-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R1524 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 126215914-126219481 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 126217442 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 208 (I208V)
Ref Sequence ENSEMBL: ENSMUSP00000099676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030658] [ENSMUST00000102616] [ENSMUST00000102617] [ENSMUST00000131113] [ENSMUST00000141990]
AlphaFold Q922G7
Predicted Effect probably benign
Transcript: ENSMUST00000030658
AA Change: I208V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030658
Gene: ENSMUSG00000028845
AA Change: I208V

DomainStartEndE-ValueType
Pfam:Tektin 17 399 2.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102616
AA Change: I208V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099676
Gene: ENSMUSG00000028845
AA Change: I208V

DomainStartEndE-ValueType
Pfam:Tektin 17 398 1.9e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102617
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128188
Predicted Effect probably benign
Transcript: ENSMUST00000131113
SMART Domains Protein: ENSMUSP00000116659
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 126 9.7e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140080
Predicted Effect probably benign
Transcript: ENSMUST00000141990
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. This gene is expressed in the testis and its protein is localized to the flagella of the sperms, indicating that it may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit male infertility and impaired motility of both sperm flagella and tracheal cilia due to altered dynein inner arm morphology and function. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 88,119,548 (GRCm39) V102L probably benign Het
Adck1 T C 12: 88,368,854 (GRCm39) Y111H probably damaging Het
Adcy10 G T 1: 165,345,972 (GRCm39) K340N probably damaging Het
Aebp1 T C 11: 5,820,089 (GRCm39) V355A probably damaging Het
Atp2b2 T C 6: 113,751,162 (GRCm39) probably benign Het
Atrn T C 2: 130,799,000 (GRCm39) V390A probably benign Het
Bpifc T A 10: 85,813,599 (GRCm39) Q315L probably benign Het
C1qtnf6 T G 15: 78,409,092 (GRCm39) probably null Het
Cab39l A G 14: 59,757,186 (GRCm39) probably benign Het
Capn12 T A 7: 28,582,189 (GRCm39) probably benign Het
Ceacam18 A C 7: 43,288,779 (GRCm39) T177P possibly damaging Het
Ces5a A T 8: 94,252,293 (GRCm39) F200I probably damaging Het
Cldn19 G T 4: 119,114,248 (GRCm39) probably null Het
Cntnap2 A G 6: 46,507,613 (GRCm39) S46P probably damaging Het
Dchs1 A G 7: 105,413,732 (GRCm39) Y1028H probably damaging Het
Exd1 A T 2: 119,355,155 (GRCm39) F253L probably damaging Het
Fam161a A G 11: 22,965,826 (GRCm39) N40D possibly damaging Het
Fam81a A T 9: 70,032,390 (GRCm39) I34N probably damaging Het
Fchsd1 A C 18: 38,098,950 (GRCm39) probably null Het
Fut11 T A 14: 20,746,234 (GRCm39) F359I possibly damaging Het
Fut7 T C 2: 25,315,159 (GRCm39) V92A probably damaging Het
Grid2 C G 6: 64,406,738 (GRCm39) F699L possibly damaging Het
Grin2a A G 16: 9,481,467 (GRCm39) S445P possibly damaging Het
H2al2b A C Y: 2,720,391 (GRCm39) F95C probably damaging Het
Hecw2 T C 1: 53,890,777 (GRCm39) D1246G probably damaging Het
Ifit1 A G 19: 34,625,032 (GRCm39) N56S probably damaging Het
Ldb3 C A 14: 34,277,313 (GRCm39) V354L probably benign Het
Lrig2 T C 3: 104,371,192 (GRCm39) Y479C probably benign Het
Ltn1 A G 16: 87,178,444 (GRCm39) V1595A probably damaging Het
Macf1 A G 4: 123,326,323 (GRCm39) V2939A possibly damaging Het
Mapre3 T G 5: 31,019,261 (GRCm39) I35S probably damaging Het
Med16 A T 10: 79,734,150 (GRCm39) L588Q probably damaging Het
Ncapg2 T C 12: 116,398,198 (GRCm39) probably benign Het
Ncstn C A 1: 171,899,716 (GRCm39) R322L possibly damaging Het
Ndst1 A T 18: 60,831,576 (GRCm39) I594N probably damaging Het
Ndst3 A G 3: 123,342,555 (GRCm39) I752T possibly damaging Het
Obscn G T 11: 59,006,681 (GRCm39) S1185R probably damaging Het
Or5b112 T A 19: 13,319,486 (GRCm39) C121* probably null Het
Or6aa1 A G 7: 86,044,020 (GRCm39) S229P probably benign Het
Or9q1 A T 19: 13,805,679 (GRCm39) L27H probably damaging Het
Otof T A 5: 30,536,900 (GRCm39) D1285V probably benign Het
Pcnx2 A G 8: 126,617,880 (GRCm39) I125T probably benign Het
Pde4a T C 9: 21,112,543 (GRCm39) S240P probably damaging Het
Pi15 T C 1: 17,690,076 (GRCm39) S126P probably benign Het
Pkhd1 T C 1: 20,188,004 (GRCm39) S3435G probably damaging Het
Plin1 C A 7: 79,376,338 (GRCm39) V133L probably benign Het
Pnpt1 T A 11: 29,080,776 (GRCm39) C7S unknown Het
Ppp3ca A T 3: 136,503,579 (GRCm39) M51L probably benign Het
Primpol G T 8: 47,039,502 (GRCm39) probably benign Het
Prlr T C 15: 10,319,419 (GRCm39) V116A probably damaging Het
Ptgr3 A G 18: 84,112,831 (GRCm39) E169G probably benign Het
Rnf139 A G 15: 58,761,266 (GRCm39) D35G probably damaging Het
Rsbn1l T A 5: 21,156,671 (GRCm39) K38M probably damaging Het
Ryr3 T A 2: 112,699,427 (GRCm39) I888F probably damaging Het
Sec16a C A 2: 26,318,394 (GRCm39) V1566F probably damaging Het
Sin3b A G 8: 73,479,915 (GRCm39) T874A probably benign Het
Skic3 T A 13: 76,286,491 (GRCm39) D891E probably benign Het
Slc5a5 A C 8: 71,344,978 (GRCm39) Y110D probably damaging Het
Smarcd2 C T 11: 106,157,978 (GRCm39) V97I probably benign Het
St6galnac2 G A 11: 116,575,313 (GRCm39) probably benign Het
Tbc1d22b T C 17: 29,789,585 (GRCm39) L149P probably damaging Het
Tenm3 A G 8: 48,682,016 (GRCm39) I2522T possibly damaging Het
Ttll5 T A 12: 85,911,342 (GRCm39) Y233* probably null Het
Vcpip1 C T 1: 9,794,727 (GRCm39) E1215K probably damaging Het
Wdr4 T C 17: 31,728,737 (GRCm39) probably benign Het
Zfp703 G A 8: 27,469,401 (GRCm39) G355D probably damaging Het
Zfp830 T A 11: 82,655,794 (GRCm39) D199E probably damaging Het
Other mutations in Tekt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tekt2 APN 4 126,216,982 (GRCm39) missense possibly damaging 0.47
IGL01900:Tekt2 APN 4 126,218,421 (GRCm39) missense probably benign 0.00
IGL02452:Tekt2 APN 4 126,218,645 (GRCm39) missense possibly damaging 0.83
IGL02563:Tekt2 APN 4 126,218,418 (GRCm39) missense possibly damaging 0.82
IGL03087:Tekt2 APN 4 126,218,660 (GRCm39) missense possibly damaging 0.63
1mM(1):Tekt2 UTSW 4 126,218,403 (GRCm39) missense probably damaging 0.98
R0747:Tekt2 UTSW 4 126,217,553 (GRCm39) nonsense probably null
R1113:Tekt2 UTSW 4 126,218,711 (GRCm39) missense probably damaging 0.99
R1308:Tekt2 UTSW 4 126,218,711 (GRCm39) missense probably damaging 0.99
R1563:Tekt2 UTSW 4 126,217,200 (GRCm39) missense probably benign 0.16
R1819:Tekt2 UTSW 4 126,217,529 (GRCm39) missense probably damaging 1.00
R1930:Tekt2 UTSW 4 126,216,610 (GRCm39) splice site probably null
R1931:Tekt2 UTSW 4 126,216,610 (GRCm39) splice site probably null
R2295:Tekt2 UTSW 4 126,217,486 (GRCm39) splice site probably null
R4888:Tekt2 UTSW 4 126,218,460 (GRCm39) missense probably benign 0.02
R4902:Tekt2 UTSW 4 126,217,263 (GRCm39) missense possibly damaging 0.95
R5202:Tekt2 UTSW 4 126,218,463 (GRCm39) missense probably benign 0.41
R5219:Tekt2 UTSW 4 126,216,057 (GRCm39) missense possibly damaging 0.51
R5839:Tekt2 UTSW 4 126,216,629 (GRCm39) missense probably damaging 1.00
R6213:Tekt2 UTSW 4 126,216,989 (GRCm39) missense probably damaging 0.99
R6498:Tekt2 UTSW 4 126,218,098 (GRCm39) missense probably benign 0.01
R6963:Tekt2 UTSW 4 126,218,110 (GRCm39) missense probably damaging 0.98
R6988:Tekt2 UTSW 4 126,217,236 (GRCm39) missense probably benign 0.02
R7148:Tekt2 UTSW 4 126,216,174 (GRCm39) missense probably benign 0.38
R8977:Tekt2 UTSW 4 126,217,266 (GRCm39) critical splice acceptor site probably null
R9340:Tekt2 UTSW 4 126,216,952 (GRCm39) missense probably benign
R9563:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9606:Tekt2 UTSW 4 126,218,693 (GRCm39) missense probably benign 0.07
R9619:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9621:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9664:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9665:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9666:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9667:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9668:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9745:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9748:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9749:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGGGGCACACAAGGAAAC -3'
(R):5'- ACTCTGAGGGACACTCATAAGGCTG -3'

Sequencing Primer
(F):5'- CGATGGGGTCACAGGGAC -3'
(R):5'- cacacacacataccacaaacc -3'
Posted On 2014-04-13